User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 4 FirstFirst 1234 LastLast
Results 17 to 24 of 30

Thread: Rare plants

  1. #17

    Join Date
    Jan 2002
    Location
    Southern CA, US
    Posts
    1,058
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    hmm...it seems to me that rare cp's are just harder to acquire here in the US, than overseas(Europe...).

  2. #18
    Moderator Colieo's Avatar
    Join Date
    Jul 2002
    Location
    Indianapolis, Indiana, USA
    Posts
    724
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I am begining to think I would like to move to Germany! A ceph, oreophila, and regia in a store like a lowes! You are definatly lucky Martin.

    Cole
    Duele no tenerte cerca, duele no escuchar tu voz. Duele respirar tu ausencia, pero, duele más decirte adiós.

  3. #19

    Join Date
    Sep 2002
    Location
    chicago
    Posts
    100
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    WOW! ask a couple of the right questions, and watch them come out the woodwork! lol! Now this is just simply too cool! i think this is what a good topic is because of the response rate, i think they answered your questions mate! hehehe! i wanna throw a curve ball in here though, hehehe( devils grin) if ********** doesnt sell that many rare, or more exotic cp's, then honestly, how can posting another place that deals these types, be in any way harm to PFT, is this trully about one reaching the next level of cp care, or is it about who can make the almighty dollar? ********** has had the same plants for most of the year, i havent seen rajah here yet, or some of the other dews or neps that people keep talking about. i bought my first plants from frank's nursery and crafts, then like most, starting out, went to the web to find more info. on these wild plants, i found **********, and some others, but! all the rest of my plants, ive bought loyally from pft, as a matter of fact, except for the sarr. species(just one ive bought here, and just one i own) i own all the types they sell here, but my real reason im here is, not for the plants, its for the forums! its for you people! its for the experience from phil, and greenhouse1! its for rampuppy, nep g, sarr0, nick, swords, and on and on and on and on! its not for the plants, you can only buy so many of the same thing!, now, im not knocking ********** at all about the plants, like i said, ive bought all of mine here, cept for my first 4, but, im sure theres others here that feel theyve only gone so far. they want to move farther, we cant let a measly sale prevent that, cause, like me, they are not gonna leave here for the sole purposes of buying flytrap elsewheres, its the warmth and friendship that keeps us all here! so show some faith! have a heart! show that site to your cp family, that can give them that special plant, and they will love you more for it! just thought id throw some cp plant politics in hereh, hehehehe, anyone wanna comment on this? love yas!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    follow your desires, even the spur of the moment has its purpose in life!

  4. #20

    Join Date
    Jun 2002
    Location
    Illinois
    Posts
    302
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    ccrider - the reason that the links aren't posted is that most of the places that sell other species also sell the same species as **********. It isn't hard to find them, especially if you search on the ICPS webring.

  5. #21
    pthiel's Avatar
    Join Date
    Mar 2002
    Location
    Central Ohio
    Posts
    195
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Martin - Thanks I will read up on that, I appreciate it.

    On the Southern Carnivores post - 2 things:

    1) I was under the impression that is was ok to post other CP sites that were not direct competitors of PFT, Phill Mann sells almost exculsively Neps and a couple of rarer Drosera. Phil (Crane) when you get a minute can you clarify this - Thanks.

    2) I have dealt with Phill Mann for years and never had a problem receiving plants. And the rates shown are in AU dollar so it is actually cheaper for us US folks. (But I am biased because I did his website)

    Ok on the rare issue - I agree that rare can be either not easily obtained or not many around, in either case one of the big problems I find is mis id'd plants so they appear rare, often not intentionally but it is difficult with the tools today to always make a good identification. Tamlin, we need your database set up so we can be sure we are getting the plant we hope for.

    Cheers
    Pete

  6. #22
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote
    -somehow get one rare plant-
    [/QUOTE]

    Still working on this part! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    Anyhow, Goldtrap, i am taking the trip recomended by Sarencia0. I've gotten some common species that propogate themselves like mad, and trade them away every chance I get for other stuff I don't have (best "moneymaker" so far has been the D. Capensis, second is the D.Spatulata...but I've only been playing the game since June). Also, when nothing is currently up for trade that I feel I can care for, I'll just send out the seeds to anyone who wants. I tell ya, you're nice to people and it comes back to you three fold!
    [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  7. #23
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I think Dodec and pthiel said it best when they said "make friends" 90% my really REALLY good plants came from other growers, either as trades or as gifts.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #24

    Join Date
    Sep 2002
    Location
    chicago
    Posts
    100
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    its very true, most places that sell the other species do sell, what is here, but! they dont have this forum! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] like i said, thats the reason i keep coming back here, as for many others. and the trading thing, i think thats ok too, if i have the extras, ill gladly just send them out to who wants them, but, im not here for that main reason, im here for the information, and also, id like to think that, even though i dont know that much, my information has helped others too. it makes me feel my time here is worth something, even go as far to say what ive gotten so far was priceless, thats my main point, no matter who sells what where, thats what keeps me here, not the plants, like i said, if everyone here wanted to, they couldve just went somewheres else, but they are here also, if i went to cooks, and bought some plants there, im still going to come back here if i wanted more fly traps, or another nep. rafflesiana, do you see my point? i think we all feel this, just show it in different ways [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] i love terrariums, ive helped on terrariums, i love flytraps, ive gotten help on them, and on neps too, but, if i found a place that sells rajah, or even more expensive neps. that are cheaper and can get them to you safely, i would want to share it without wanting to think its going to step on someones toes, i guess im looking at it a lil more inocently then i should, but thats how i am, if i like or even love something, i want to share it all with out someone saying " you cant do that, it will offend someone" or something like that, cause, if your really doing your hobby that you love respectfully, it shouldnt step on no ones toes at all, right? [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    follow your desires, even the spur of the moment has its purpose in life!

  9. Page 3 of 4 FirstFirst 1234 LastLast

    Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •