User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 3 123 LastLast
Results 1 to 8 of 21

Thread: Alright, i've had enough of this...

  1. #1

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    ok, I just wanted to make this thread cause I want everyone to scan their savage garden books for errors on what per wrote... why am I asking? I found several myself:

    Peter said, in the savage garden, that Nepenthes clipeata is highland!!! So I went off and treated it like your ordinary highland, nice, wet soil, cool temps, and other things... and it starts dying... [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] Then I go to the BACPS meeting to find outthat it is LOWLAND!!! So when I got home and put it in my lowland terrarium, and it's starting to recover. THEN, last night, I'm talking to goldtrap, and I find out that the S. x cobra nest is Sarracenia rubra x purpurea, goldtrap said, "look at page 89 in sg" So I look, and there it says S. rubra x purpurea is S. 'chelsonii' !!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img] I'm not sure who is wrong on that last error, the person I got the info from, or the savage garden...
    This is why I ask EVERYONE to look at their sagave garden book and look for errors, and post them here, I really need to know. I, and I don't think anyone else wants to, loose a beautiful rare, and special plant.
    Thank you,
    Spectabilis73

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    Spec,
    Why don't you e-mail the author, Peter D'Amato? Doesn't he own (or partly own) California Carnivores? You should be able to get in touch with him via their website.
    Someone correct my if I am wrong please.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3
    Far too old to grow up now. Kate's Avatar
    Join Date
    Aug 2002
    Location
    Vancouver Island
    Posts
    429
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yes, you can get intouch with him through California Carnivores.

    As to the S. x chelsonii several other sources have the same hybrid listed as the Savage Garden (which incidentally is S. purpurea x rubra)

    As for the Misplaced N. clipeata, there is the very disticnt possiblility that it was a publishing error, they are very common and often times the author has no idea they have happened until someone POLITELY points it out to them.

    Email Peter, he'll be best able to deal with this.

    Edit: I would also like to add that I do think it was somewhat irresponsible of you to say that S. x chelsonii was an error without first looking for additional sources of info. Next time try looking for additional sources first [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    I typo, therefore I edit.

  4. #4
    Far too old to grow up now. Kate's Avatar
    Join Date
    Aug 2002
    Location
    Vancouver Island
    Posts
    429
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Spec,

    I'm sorry, that last post of mine came off sounding harsh,which wasn't my intention.
    I typo, therefore I edit.

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    S. 'Cobra's Nest' is a cultivar so it could very well be the hybrid of purpurea x rubra. After all P. 'Weser' and P. 'Sethos' are both hydrids of the same cross and to all intents and purposes are treated as seperate plants.

    Errors happen in books and that is why I always say the stuff in 'Garden' or any other CP book should only be taken as pointers.

    Other errors:

    -Pete says that N. villosa is an easy plant suitable for beginners if I recall correctly.

    -The book has it as U. reinformis, the correct spelling is reniformis.

    -I would totally disagree with Pete's cultivation recomendations for the tropical and epiphytic Utricularia. Especially the weight he puts on drying the plants out.

    -Many of the Sarr cultivars Pete has in the book are invalid or unregistered (S. oreo 'Don Schnell' and S. purp 'Red Ruffles' are a couple I remember off hand.)
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6

    Join Date
    Feb 2002
    Location
    menomonie
    Posts
    1,101
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yes, Cobra Nest is a cultivar resulting from a purpurea x rubra cross. The chelsonii is a latin name originally given when it was thought the hybrid was an actual species. So all purpurea x rubra hybrids can be called chelsonii, but only the particular clone called Cobra Nest can be called Cobra Nest. Hope that helps clear that little bit up.

  7. #7

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Red face

    yah, well, books aren't everything, thats for sure. I read another book that had what turned out to be very untrue VFT info.
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

  8. #8
    Tony Paroubek's Avatar
    Join Date
    Oct 2001
    Location
    Far Away NY
    Posts
    4,640
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Keep in mind that if your growing the clip-1 N. clipeata clone it is not pure N. clipeata. It is N. clipeata x (N. clipeata x N. eymae). As for highland/lowland; it is more highland than lowland. Technically I would call it intermediate rather than true lowland or highland. I would consider pure N. clipeata to fall in this range also. I would be interested to hear what your highland and lowland growing parameters are since I have tossed all sorts of varied growing conditions at Clip-1 and it grows fine in just about everything.

    While I agree that N. villosa should probably not be called an easy plant since it is a bit misleading. This species is actually very easy to grow given the proper growing conditions. The hard part is in providing those conditions not in growing the plant.
    Tony
    Is that a Nepenthes in your pocket or you just happy to see me?

Page 1 of 3 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •