User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 12

Thread: Big encyclopedia mistake

  1. #1

    Join Date
    Mar 2003
    Location
    North Central Ohio
    Posts
    394
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I was "working" on research for a paper i have to write when i decided to look up carnivorous plant on our britannica encylopedia cd-rom. I read what it said and it all seemed correct. Then i searched venus flytrap and found some bad mistakes. Here's the article:

    "Flowering perennial plant (Dionaea muscipula), sole member of its genus, in the sundew family, notable for its unusual habit of catching and eating insects and other small animals (see carnivorous plant).

    Native to a small region of North and South Carolina, it is common in damp, mossy areas. Growing from a bulblike rootstock, the plant bears hinged leaves with spiny teeth along their margins and a round cluster of small white flowers at the tip of an erect stem 8-12 in. (20-30 cm) tall. When an insect alights on a leaf and stimulates its sensitive hairs, the leaf snaps shut in about half a second. Leaf glands secrete a
    red sap that digests the insect's body and gives the entire leaf a red, flowerlike appearance. After 10 days of digestion, the leaf reopens. The trap dies after capturing three or four insects."

    First, vfts are not in the sundew family. And second it is the sun that gives the trap a red coloring.


    And then under sundew it said this:

    "Any of about 100 species of annual and perennial flowering carnivorous plants in four genera, notably Drosera, that make up the family Droseraceae (sundew family).

    Sundews are found throughout tropical and temperate regions. Their leaves are usually in a basal rosette. Both leaf surfaces are generally covered with sticky, gland-tipped hairs and sensitive tentacles that trap insects. After the trapped prey has been digested by enzymes secreted by the tentacles, the leaf reopens, resetting the trap. The best-known sundew is the Venus's-flytrap."

    I thought an encyclopedia would have the correct info. since people use them to write reports and stuff but i guess that's not always true. [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]

    -buckeye

  2. #2

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    ummm, actually, they are in the sundew family

  3. #3
    Jeremiah Harris's Avatar
    Join Date
    May 2002
    Location
    Colorado Springs
    Posts
    1,239
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The Dionaea (Venus Flytrap) is in the Droseraceae family, so is the Aldrovanda, Drosophyllum and Drosera (sundew). But Droseraceae is in the Nepenthales Order. But that Venus Flytrap is not a sundew but it is in the same family. Hope that makes sense.

    Jeremiah

  4. #4

    Join Date
    Mar 2003
    Location
    North Central Ohio
    Posts
    394
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Exclamation

    oops. I guess i'm the one who doesn't know what i'm talking about. Sorry about that.

    The vft is in the sundew family but is not a sundew, right? So that part in the sundew article that says a vft is sundew is wrong. Is this right?

    Thanks,

    -buckeye

  5. #5
    Jeremiah Harris's Avatar
    Join Date
    May 2002
    Location
    Colorado Springs
    Posts
    1,239
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The Venus Flytrap is not a sundew.

  6. #6

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I don't think it's the "sap" that makes the traps red. I'm pretty sure that the pigment is in the cells, its function being to protect the plant from UV radiation.




  7. #7
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    FYI: species classification:
    Kingdom, Phylum, order, class, family, genous, species. I think I'm right on that.

    VFT's are in the Sunder family, but a different genous.
    Hope that helps.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Close, it is actually:

    Kingdom, Phylum, class, order, family, genous, species [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    But only us biology dorks know that LOL
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •