User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 5 of 5

Thread: Polyploid

  1. #1

    Join Date
    Jan 2003
    Posts
    390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Polyplod makes the plants speed up and the plant starts to make extra sets of chromosomes. Does anyone know any chemicals to make the Cps do this and are the chemicals and this process ok for Cps? [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]
    What is the Propability of the Propability?
    If someone is addictied to therapy how will you treat them?

  2. #2
    Tony Paroubek's Avatar
    Join Date
    Oct 2001
    Location
    Far Away NY
    Posts
    4,640
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The chemicals used in a lab to create polyploid plants are highly toxic and carcinogenic. Not something you want to mess around with lightly. The process is also very technical and results are never certain.

    Polyploid plants as a general rule actually grow slower and take longer to mature. Plant tissue tends to be thicker and longer lasting. They can have some positive features such as larger plant structures.

    Tony
    Is that a Nepenthes in your pocket or you just happy to see me?

  3. #3

    Join Date
    Jan 2003
    Posts
    390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    That would perrty cool for neps Have Huge pitchers that are like 3ft or 4ft big. I just wanted to know if it was ok and for public use. I am sure not going to mess with it I just wanted to know if it something you can buy on line and it would be easy to use. I am not going to be playing around with that stuff. Thanx for the information. [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    What is the Propability of the Propability?
    If someone is addictied to therapy how will you treat them?

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Just a note, sometimes increased ploidy does nothing but reduce the total number of cells in an organism. One large cell with 5 times the DNA is equivalent to 5 small cells with 1 times DNA.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5
    noah's Avatar
    Join Date
    Aug 2001
    Location
    Senegal
    Posts
    538
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I believe Ivan Snyder has done some experimenting with this on dorseras, as he has created some artificially fertile hybrids by doubling chromosone counts and such.

    -noah

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •