User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 8 of 8

Thread: verizon ferret commercial

  1. #1
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,432
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    sorry so long [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img] but please read!
    Ok, I don't know how many of you know very much about ferrets so let me give a little background. ferrets are not rodents. they are from the Mustelidae family. which includes badger, wolverine, pine marten, sea otter, and skunk...etc etc. they are not mean. now do they bite? well, if you beat you dog or cat do they bite? if you slap your little sister does she bite? sure they can... like anything else. also many think that ferrets carry rabies. wrong. the virus has never been found in the saliva of a ferret. also if they do (I have seen the statistics but can't remember the numbers... trust me very small compared to dogs and cats!! ) get rabies they get dumb rabies. they just kinda sit there till they die. they don't get mean like other animals
    this commercial is so wrong they don't even have a ferret sound. here is the main problem with this showing on the TV. many of us fight and fight to help people understand the truth about ferrets. then this comes up and because it is on TV... that is what they believe. so please help all of us that know better get this commercial off the air. from what I understand they wanted to use a cat first but decided not to because they were worried about what cat lovers would say. so why not use a animal that many people only have the wrong information on? so they chose a ferret. just go to vote verizon ferret comercial off site and sign the petition.
    thanks very much!
    Andrew
    here are my guys! (and gals! )
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  2. #2
    Guest
    Awww how sweet! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] They're so adorable.. I love ferrets. I just spent the better half of a day photographing a few of the ferrets wild cousins.. they're so playful, curious, and intelligent.
    I'm deffinately signing the petition..

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Lightbulb

    I gotta tell ya, I LOVE ferrets.

    on the other hand, the commercial being referenced made me laugh REALLY hard.

    .
    Quote
    then this comes up and because it is on TV... that is what they believe[/QUOTE]

    Anthony Hopkins does really eat people, either. I don't think anyone out there really thinks he does, but he did it on TV.

    If anyone get the idea from that commercial that ferrets really act that way, they're too dumb to own one, anyway. Just my humble oppinion.
    Quote
    then this comes up and because it is on TV... that is what they believe[/QUOTE]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4

    Join Date
    Aug 2002
    Location
    Canada
    Posts
    409
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I love ferrets too! They really are quite cute! I knew someone who had one as a pet, and it was much like a cat in the sense that it came to when when it wanted to play or snuggle, but when it didn't want either of those things it went on to happily do it's own thing and pay little attention to you! They are collectors though, just like skunks! They'll get a nice pile of your socks, toys, whatever it finds that grabs its attention and hide it all somewhere it can find them later!

    I'd have one or two, except we already have a dog and a cat and my hubby is allergic to both!
    To live we must learn to forgive.

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    adnedarn,

    I do have to argue a little. Ferrets do get rabies and it is the ferocious kind (only herbivores get dumb rabies) but you are correct that the stats for ferret rabies is extremly low. I only know of 3 cases in the past 10 years (as reported by the emerging/outbreak disease bullitens I recieve.)

    I have not seen the commercial but it sounds idiotic (as any commercial involving a disease would be.) I have added my vote to the petition.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,432
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    Pyro,

    I argue right back... as stated in ferrets for dummies by Kim Schilling (this is the ferret bible as the savage garden is cps)on page 32 it says
    "zero reports have been made of rabies being transmitted from a ferret to a human, and only a small handful of rabies in ferrets have ever been documented. in fact, dogs and cats, while incidences are low, are at much greater risk of being exposed to rabies, thus putting you at greater risk.
    -ferrets have little opportunity to come in contact with a rabies-infected animal in the first place.
    -infected ferrets are thought to contract dumb rabies and die quickly after being infected. (to find out what dumb rabies is, compared to furious rabies, see chapter 15.)"
    CHAPTER 15 PAGE 214
    "rabies can manifest itself in one of two ways: furious rabies and dumb rabies. with furious rabies, the infected animal exhibits intense aggression, biting, and foaming at the mouth. with dumb rabies, the animal becomes lethargic and deathly ill and wants little to do with people or other animals. animals with dumb rabies don't attack and usually die quickly. although ferret infection is extremely rare, studies indicate that ferrets exhibit dumb rabies, with death occurring seven days (on average) after the ferret has been infected."
    if you have some documentation otherwise I would be very interested in having a look at that. this is the same info I have always found on the internet. why have I looked this up on the internet so much?? because people have this stereotype about ferrets.. the reason we want the commercial to go bye bye... THANKS FOR THE VOTES!!!
    Andrew
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  7. #7
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Andrew,

    I would love to offer you the references I read but they all came to me via a CDC based email newsletter and were deleted after being read. The last one I read was about 8 months ago in a black-foot recovery population in (I want to say) Utah. Only one ferret got it and it was euthanized promptly to avoid spread into the rest of the breeding population.

    As far as the dumb rabies goes your book says it all:
    Quote
    infected ferrets are thought to contract dumb rabies and die quickly after being infected[/QUOTE]

    The nature of the virus is such that any animal with carnivorous tendancies will gets ferocious rabies. It is a result of where the virus localizes in the brain. That the animals tend to die fast is the key here, rabies strikes ferrets so hard and fast that they usually progress from ferocious to death in a very short time so are unable to find and attack anything to pass the virus on. That, coupled with the low frequency of ferret infection keeps the trend from being easily observed.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #8
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,432
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    pyro,
    to be completely honest I don't claim to be an expert in anyway... although the point I am trying to make is if an animal never gets mean be it dumb rabies or dying before the virus gets to the brain and makes the animal mean a ferret will not be seen in the way the commercial makes them look... the ferret jumping all over the persons face while he tries to get away and a lot of strange sounds that a ferret would never make. although I see the point you are tying to make and appreciate you pointing that out. one day all the research will be in and we will know for sure which rabies they get. until then we know for sure the ferret doesn't get mean and doesn't transfer the virus since it never gets to the saliva. agree?
    Andrew
    here is some neat stuff i found on the net..
    "Need numbers?? According to the CDC ( Center for Disease Control ) From 1984 to 1989 there were:
    >> 10 rabid ferrets ( one is a possible error in diagnosis, two used questionable testing methods)
    >> 24 rabid humans
    >> 701 rabid horses
    >> 2240 rabid dogs
    >> 2310 rabid cats
    >> 3395 rabid cattle
    From 1958, when the CDC began compiling data on rabies, fewer than 25 ferrets have been found rabid (as of 1996). Several studies have been done to determine the possibility of a ferret passing rabies. The results find that basically a ferret is a "dead end" for the virus. The ferret blocked the virus in all three areas required for transmitting the disease. It proved to be relatively resistant; exhibited only the dumb form of the diseases; and did not shed the virus in its saliva to any biologically significant degree."

    "Under the heading "serious injury" JAVMA (Journal of the American Veterinary Medical Assoc.) reported dogs were responsible for 44,000 serious attacks per year, versus 12 per year for ferrets. Need more.... at an estimated population of 54,200,000 of dogs in 1995 there were 64,575 bites PER MILLION reported versus ferrets at an estimated 8,000,000 there were only 8 per million!!
    Other amazing facts... In New York City, in 1985, it was far more likely to be bitten by a human being than a ferret. In Pima County, Arizona, you were twice as likely to be bitten by a cat than a ferret. All reported cases with children have evidence to suggest parental neglect as the root cause of the ferret hurting the child."
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  9. Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •