User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 24

Thread: Favorite summer activity

  1. #9
    Guest

    Exclamation

    Hiking mountains in search of Pings, watching bears and other wildlife, wading waste deep in muck and sorting through reeds for Utricularia... my favorite thing about summer is 20 hours of daylight! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

  2. #10
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Whitewater rafting/kayaking
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #11
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Exclamation

    Oh, where to begin?
    Beach....LOVE the beach (gotta have waves, though...no calm water)

    Woods...Hiking in the woods rocks.

    Ever been to the Sunken Forrest on Fire Island? You can hike through the woods to the beach...talk about the best of both worlds!

    Frisbee....Love to toss the disk!

    OH,YEAH: BBQ! steaks, burgers, dogs, grilled veggies....mmmmm....marinated puerto bellos with tomato and melted mozzarella.....

    Anyone wanna come have a BBQ?

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/rolleyes.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #12

    Join Date
    Dec 2002
    Location
    Upper Maryland
    Posts
    318
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Wakeboarding/skimming at the beach, hiking with or without a trail, playing "capture the flag", or just sittin around sketching my cp.

    Quote
    Anyone wanna come have a BBQ?[/QUOTE]

    I do, me me me! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

    Mike [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] (Don't forget the ketchup [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] )

  5. #13

    Join Date
    Sep 2002
    Location
    Cleveland, Ohio
    Posts
    95
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    when i was younger i used to love skateboarding, but then all of my skate pals moved away to college. unfortuantely i am taking a physics summer class at my college ( yuck!!!!!&#33[img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] which is kinda time consuming...grrrr. as of late i have been going to the beach, having BBQ's, and checking out various parks ( along with the occasional bike ride) a lot with my pals. summer is also the perfect time to play shows and go to shows!!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    In bleak description the waves come crashing; battering the very instinct of every lusting moment to fulfill this gaping desire. A mouth as dry as soot and how it once had tasted of life, fit within a momentís time; And how those fleeting days laid in the light of blissful suffering. -me

  6. #14

    Join Date
    Aug 2001
    Location
    Connecticut
    Posts
    63
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Feeding flies to my Green Dragons.
    John Milford CT

  7. #15

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    Quote (John Milford CT @ July 03 2003,7:25)
    Feeding flies to my Green Dragons.[/QUOTE]
    dtto [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

  8. #16

    Join Date
    Jun 2003
    Location
    Sacramento, CA
    Posts
    30
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    When I am not trying to find someplace that's nice and cool to rest; I enjoy riding the moto swiftly through the miles of twisties in Northern California, attending Burning Man, cooking outside, rummaging through the flowerbeds for insects to feed my CP's, roasting coffee beans, and drinking lots of wine (not while riding of course).

    Not much different than any other time of year.

    cheers!
    Chris
    Endlessly seeking a hybrid Dionaea muscipula big enough to eat my co-workers.

  9. Page 2 of 3 FirstFirst 123 LastLast

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •