User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 4 of 7 FirstFirst 1234567 LastLast
Results 25 to 32 of 54

Thread: music

  1. #25

    Join Date
    Aug 2001
    Location
    Connecticut
    Posts
    63
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Here`s mine in no order- Allman Bros.,Frank Zappa,Greatful Dead,Stones,Marshall Tucker,Pink Floyd. p.s. in my opinion Rap music makes Afro-Americans look like a bunch of braindead thugs, ever hear these guys talk during an interview?
    John Milford CT

  2. #26
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Red face

    Mike King,
    See what happens when I reply to your PM BEFORE I read the thread.....DOH!

    You got to mean the guys?!? [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img]

    Really cool!

    And on the subject of vapor trails, I actually do like it, but it took me a while to warm up to some of it. I gotta tell ya, the concert I saw in June was what did it for me with Victory! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #27
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My favorite music is PUNK (and NO I do not wear my pants sagging to my ankles.)

    Favorite bands would be:

    Strung OUt
    Millencolin
    Less Than Jake
    Samiam
    Pully
    Lagwagon
    Ten Foot Pole
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #28
    noah's Avatar
    Join Date
    Aug 2001
    Location
    Senegal
    Posts
    538
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Guys,

    My favorite music would have to be classical, Bach, Chopin, etc, mencini is nice.... and second would be jazz and swing. Bluegrass is also not bad...

    I guess I'm a little different in the cp enthusiast world. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] (no surprise to me).

    I'm not into any of the "hard noise" stuff, punk, rock, etc, but I LOVE music with any recognizable amound of quality in it.

    does ANYONE else here think the same?

    noah

  5. #29
    It's been one of dem days BigCarnivourKid's Avatar
    Join Date
    Jun 2002
    Location
    I live in Chaffee County, Colorado, USA
    Posts
    3,673
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs up

    Yeah, I'd have to say I listen to more classical than anything else. No one else in my house likes it. I haven't figured out whats wrong with them. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    ---Steve Allinger---

    How come chicken fingers are bigger than buffalo wings?

    My Grow List

  6. #30

    Join Date
    May 2002
    Posts
    97
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    not many people like rap huh? i do, thats about all i listen to. i dont see nothing wrong with rap, and thats my opinion.

  7. #31

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I used to be a big jazz fan. When I was in highschool I'd spend all my money on records (yep, vinyl). I will still buy 50s-60s Bluenote stuff if I see it. I even studied jazz saxophone at at university.

    I on the end of an electronic music phase right now. Once the drugs wear off it's not nearly as interesting.

    Ironically, this has left me listening to a lot of the crappy pop music which I shunned while I was in highschool.

  8. #32
    technoracer's Avatar
    Join Date
    Jun 2002
    Location
    ohio
    Posts
    584
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    well, i just got booted off the web after typing out a response for 10 min...(... aol.)
    now i'll just give you the short version!
    in no order, just what i remember that's worth mentioning...

    tool
    pink floyd
    savatage
    yngwie j. malmsteen
    iron maiden
    ozzy
    steve vai
    joe satrini (taught steve vai how to play guitar)
    lords of acid
    praga khan
    my life with the thrill kill kult
    enigma
    massive attack
    chemical brothers
    crystal method
    queensryche
    korn
    dirty vegas (! buy this cd &#33[img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    fleetwood mac
    al di meola
    nicolo pagannini's 24 carpices
    slayer
    testament
    king diamond
    iron maiden
    dokken
    eminem
    ministry
    wasp
    rob zombie/white zombie
    system of a down


    peace,
    technoracer
    Power corrupts. Absolute power corrupts absolutely.
    Some days you're the pigeon, some days you're the statue.

Page 4 of 7 FirstFirst 1234567 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •