User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 2 FirstFirst 12
Results 9 to 15 of 15

Thread: Girls are so strange now-a-days.

  1. #9
    It's been one of dem days BigCarnivourKid's Avatar
    Join Date
    Jun 2002
    Location
    I live in Chaffee County, Colorado, USA
    Posts
    3,673
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Gads, I won't mention the musk. My wife has already put her foot down on crickets and possibly meal worms being in the house for food. I'll just pretend I don't know nuthin' [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] .
    Yea, he/she? is 18" long, but since I said "she brought a friend over" and people are tall not long (stay with this topic guys [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] ) I used 'tall' just to be consistant with my story.
    Man! a 20' garter snake would be something to see though! MY mother-in-law has a real snake phobia. When my daughter pulled this one out to show her, she lit out the door and wouldn't come back in 'till it was back in the container and the lid was on. A 20' snake and she would still be haulin' _ _ _ down the road. She's pretty spry for her age [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] .
    ---Steve Allinger---

    How come chicken fingers are bigger than buffalo wings?

    My Grow List

  2. #10
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs up

    Saaaaayyyyyyy,
    Now you have a really good way to get the in laws to leave when they've worn out their welcome!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #11
    It's been one of dem days BigCarnivourKid's Avatar
    Join Date
    Jun 2002
    Location
    I live in Chaffee County, Colorado, USA
    Posts
    3,673
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    lol. Schloaty, the only problem is she lives right behind me, 26' between the back of her house and the back of mine, with no fence between the places. There are times when it's a pain.

    Pyro, thanks for the snake ID and feeding tips. Now I can do a more specific web search for the care of it [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] .
    ---Steve Allinger---

    How come chicken fingers are bigger than buffalo wings?

    My Grow List

  4. #12
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    BCK,

    Glad I could assist. These guys are super easy. If you can find it, check out the book Exotic Pets by Arthur Rosenfield (not positive on that spelling.) It is a great book on care of reptiles and other exotics. As a quick starter from an experienced herper, give her a place to hide. Snakes hate being "on display" all the time as it makes them feel vulnerable and the often will get highly stressed.

    Drop me a line if you want any extra help

    Pyro
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #13
    It's been one of dem days BigCarnivourKid's Avatar
    Join Date
    Jun 2002
    Location
    I live in Chaffee County, Colorado, USA
    Posts
    3,673
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks Pyro,
    I think she's going to try to take good care of Kalin. She actually checked a book out of the school library on the "Care of Uncommon Pets" by William J. Weber, DVM today. I'll see if I can't find Exotic Pets by Arthur Rosenfield, too.
    ---Steve Allinger---

    How come chicken fingers are bigger than buffalo wings?

    My Grow List

  6. #14
    Send in the Clones Houstonherp's Avatar
    Join Date
    Jul 2002
    Location
    Houston, Texas USA
    Posts
    405
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    BCK -

    As someone who runs a herpetological supply business (I can't resist a plug - Houston Herp Supply, or Houston Herp Supply), I would recommend "Garter Snakes" from T.F.H. Publishing. It's a decent beginner book that covers the care and maintenance of garter snakes specifically, and is LOADED with fantastic color pictures. You should be able to get it at your local pet store (if they have a decent reptile section AND a decent literature section - tough combination for most pet store owners...). If not, feel free to drop me a line and I'll be happy to get one to you, along with anything else you need for your new "cold and scaly" friend.

    On a side note - I sure am glad to see people act in a less fearful manner when I show them my CPs...too many people are unreasonably frightened of reptiles, especially in these "enlightened" days...
    Mike Howlett

    "Leuc, I am your flava!"

    Now we know Princess Leah's last name: Wilkerson!!

  7. #15
    It's been one of dem days BigCarnivourKid's Avatar
    Join Date
    Jun 2002
    Location
    I live in Chaffee County, Colorado, USA
    Posts
    3,673
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks for the tip Houstonherp. I'll look for that book this weekend.

    Re: side note - Unfortunately there's still a lot of people out there though that are. I still have to chuckle when I think of my mother-in-law, who's 72, racing through the door to get away from a little 18'' garter snake. In her defense though, she grew up on a farm in Nebraska and was taught that all snakes were dangerous.
    ---Steve Allinger---

    How come chicken fingers are bigger than buffalo wings?

    My Grow List

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •