User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 4 of 6 FirstFirst 123456 LastLast
Results 25 to 32 of 41

Thread: College

  1. #25

    Join Date
    Sep 2002
    Location
    Ogden, UT
    Posts
    423
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    This absolutely bites the big one. My Control systems Engineering book that is. Final exam is at 9:00 A.M. in the morning and I still have two homework assignments to finish. Then you might ask...Why are you on the computer if you have an exam in the morning...because I'm a professional procrastinator.

    Then I just need to take my Electro Magnetic Waves, Ordinary Differential Equations, and Advanced Communications exams. No Prob. Hmmm....I suddenly feel like a drink.

    I feel for ya Darcie.



    joe

    P.S. If I miss spelled anything....~
    Signature.

  2. #26
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,432
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    Hello Darcie. Nice to see you around. I've been wondering where you have been.
    To the rest of you I have one thing to say. "Word." (My definition of "word" used in this syntax at this time is... I agree with buckeye, PAK, snowy, ozzy, nick and colieo."
    Oh, one other thing. "Be nice." [img]http://www.**********.com/iB_html312/non-cgi/emoticons/cool.gif[/img]
    Andrew
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  3. #27

    Join Date
    Mar 2002
    Posts
    1,338
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Tamlin Dawnstar @ Dec. 09 2003,11:00)]Uhhh, I just wanted to say Hi Darcie, nice to see you around. If you need some new Sundews in the spring I'd be happy to send some off to you. It's got to be nice to be out of school for a bit, this was always the hardest part of the term with finals and projects due and all that socializing you're probably doing. Anyways, I have been wondering how you were doing, so thanks for stopping by. Hey, don't forget to post your photo on the "Well, it's that time of year" thread on the General Forum.
    Ahhh... back on topic. I was wondering how long it would take. [img]http://www.**********.com/iB_html312/non-cgi/emoticons/rock.gif[/img]

    Heya Darcie... [img]http://www.**********.com/iB_html312/non-cgi/emoticons/smile.gif[/img]
    There's a tunnel at the end of the light...

  4. #28
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (joseph @ Dec. 09 2003,5:11)]This absolutely bites the big one. My Control systems Engineering book that is. Final exam is at 9:00 A.M. in the morning and I still have two homework assignments to finish.
    I got you beat my frined [img]http://www.**********.com/iB_html312/non-cgi/emoticons/smile.gif[/img] Model Systems final today. 4 questions worth 1/3 of the grade in tha class. Last year every single person in the class got 1 of the questions wrong. And the test is designed to take a minimum of 5 hours. Man I love life.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #29
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Boy, I'm so glad that college is 8 years behind me.
    I still remember the pressure of finals. Yuck.
    I traded that pressure in for the new model, though: WORK!

    YAY!
    Anyway, Darcie, keep your chin up! As we say in NY, Yehbe ah'ight! [img]http://www.**********.com/iB_html312/non-cgi/emoticons/cool.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  6. #30

    Join Date
    Mar 2003
    Location
    North Central Ohio
    Posts
    394
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yes, Welcome back Darcie! [img]http://www.**********.com/iB_html312/non-cgi/emoticons/smile.gif[/img]

    I just got home from my math 150 final. It was possibly the most difficult test Iíve ever taken!!! I had my psych final on Tues. and it wasn't too bad. On Mon. i had a paper due for English. Those were my only 3 classes this quarter so now Iím on Christmas break until January. [img]http://www.**********.com/iB_html312/non-cgi/emoticons/biggrin.gif[/img]

    -buckeye

  7. #31

    Join Date
    Apr 2002
    Location
    Los Angeles, CA
    Posts
    809
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh, I'm currently waiting to take my Art History of China final. Why do I have to take an 8pm final? Insane..it's an elective...nothing to do with my Masters in Education: Computers and Ed.

    Anyway, not to go back to that controversial part of this post but there is always a possibility of learning disabilities. I was always considered very intelligent but everyone thought I was pretty lazy and careless when it came to math (got a 5 percentile on my SATs). But it was an undiagnosed disability, and because my parents didn't believe that I was trying quite hard to understand what was going on I wasn't diagnosed until I turned 18 and went off to college (where I promptly signed up to take the tests). Point is, it takes patience, time, and understanding on the everyone's part. Cheers.
    A flytrap ate my homework!
    -Michelle

  8. #32

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks everyone for the nice post about sticking up for my bad spelling, and I'm sorry to those who it botherd and how it got everyone all mad at each other. I guess I was having a bad spelling day, sorry.

    I'll try to be better about proofing post. Also, WickedThistle is rather keen most of the older members know my excessive list of disablities, but I was surprised to see a newer member pick up on it. (FYI: dislexia, ADD, generalized anxioty(sp?), depression, mild neromuscular distrophy)

    As to the spelling corrections, don't worry about it, the list thing doesn't bother me, but it probubly should be done via PM so it doesn't distress others.

    I'm glad to see so many people are still here and I just found out about the trip to my local gardens wich sounds totally awsome. (Bring money, if we get there at a good time they will have some of the most awsome plants for sale! They have the most incredable clone of "typical" VFT ever, it looks just like the origenal painting of them, with the perfictly red inside and dark green leaves... wait all of their plants are cool... they have red varient N. Ventricosa but I think all the other neps are common varients... oh and they pot all the plants in nice big pots with really high-quality growing media and and.... must calm down, can't accomidate all of the plants)
    So, hi again all [img]http://www.**********.com/iB_html312/non-cgi/emoticons/biggrin.gif[/img]
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

Page 4 of 6 FirstFirst 123456 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •