User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 6 12345 ... LastLast
Results 1 to 8 of 47

Thread: Excellent site

  1. #1
    fatboy's Avatar
    Join Date
    Aug 2001
    Location
    Darwin, Australia
    Posts
    571
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I saw this URL posted on another forum, it is truly one of the most brilliant sites I have ever visited. Very well done and amusing.
    Enjoy all, I look forward to your comments and to hearing how long it takes every one. It is MUCH better with sound.

    Puzzle? site

  2. #2
    scottychaos's Avatar
    Join Date
    Aug 2001
    Location
    Western New York, USA
    Posts
    2,970
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    hmmm..all I could do was zoom-in on the guy with the telescope..then I couldnt do anything else..
    no sound at all..speakers are on.
    might be a firewall problem at work..I will try it at home tonight!

  3. #3

    Join Date
    Oct 2003
    Location
    Michigan
    Posts
    826
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I don't get it...
    I thought you people where \"Plant Geeks\", Look at me Now...

    Growing List-
    http://www.**********.com/cgi-bin....t=17062

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hmmm. Got into the hut with the machinery....Can't figure out the button combo.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That was fun Troy. Only took me about 10 minutes but I'll probebly go back again tonight when I can have the sound on.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    AHA! figured it out...helps to be able to read the symbols on the buttons....
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  7. #7
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    What hut? What buttons? I think I landed somewhere totally different but I won't say anything for now. Let others expllore it.

    Pretty cool Troy. [img]http://www.**********.com/iB_html312/non-cgi/emoticons/smile.gif[/img]
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  8. #8

    Join Date
    May 2003
    Posts
    1,265
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I got the guy to ski back down the hill, but what now?

    SF [img]http://www.**********.com/iB_html312/non-cgi/emoticons/rock.gif[/img]

Page 1 of 6 12345 ... LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •