User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 25 FirstFirst 12345612 ... LastLast
Results 9 to 16 of 195

Thread: Which religions are represented here?

  1. #9

    Join Date
    Jul 2003
    Location
    Hot, humid Singapore....but unfortunately, in a flat 7 stories up, sunlight blocked by tall buildings.......
    Posts
    644
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Catholic!
    A lady went into a grocery store and looked into the turket section. She needed a bigger one for her family, so she asks the stock boy: \"Do these turkeys get any bigger?\"

    The stock boy replied: \"No ma'am, they're dead\"

    Msn/email - wezx1@hotmail.com

  2. #10
    Odysseus's Avatar
    Join Date
    Jan 2004
    Location
    Utah
    Posts
    341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Wezx-

    Was that a request for Catholic or were you saying that your ARE Catholic? At any rate, Catholic is on the list so far and so come back and vote on saturday.
    Odysseus
    Wife and I in the Netherlands. Sure miss living out there.

    My growlist
    A list of beginner CPs

  3. #11

    Join Date
    Jul 2003
    Location
    Hot, humid Singapore....but unfortunately, in a flat 7 stories up, sunlight blocked by tall buildings.......
    Posts
    644
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i was saying that i am Catholic
    A lady went into a grocery store and looked into the turket section. She needed a bigger one for her family, so she asks the stock boy: \"Do these turkeys get any bigger?\"

    The stock boy replied: \"No ma'am, they're dead\"

    Msn/email - wezx1@hotmail.com

  4. #12
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Messianic Jew. Didn't expect that category to show up, but that nails it. I was born and raised Jewish. When I was in fifth grade my parents also sent me to a Synogogue, where I learned how to read and speak Hebrew. At 13 I had a Bar Mitzvah. Though I learned about Judaism I didn't learn about faith. Consequently, by the time I was 15 I was a self-described atheist. However, in college, through the prayer and friendship of some people from a fellowship group, called InterVarsity Christian Fellowship (IVCF), I became a Christian. Being a person who wanted proofs, I never got them - or at least I never got anything that coudn't be rationalized away. Instead, however, there was enough evidence about the truth of Christianity to put my faith into it. I've been a part of Southern Baptist churches, Free Methodist, Mennonite, and Presbyterian. While I respect their distinctives I would never identify myself as being an ...ist / ite / ian. Faith transcends the man-made institutions and gives me a new family and a new life after this one ends.

  5. #13

    Join Date
    Jul 2003
    Location
    central upstate New York
    Posts
    439
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Exclamation

    I believe there are as many different religions as there are people. Every one of us has our own belief system & sometimes you can categorize that into some recognized 'religion,' but there are many sects & sub-sects. Hope you discover just what it is you are looking for. [img]http://www.**********.com/iB_html312/non-cgi/emoticons/smile.gif[/img]
    Restore our biosphere, create a new culture of kindness.

  6. #14
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My best friend describes me as a "recovering Catholic" I guess that kinda works for me. I don't really have a fixed religion just my own set of moral beliefs that are sort of picked from everywhere. I guess you could call me a Neo-Patchworkist LOL
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #15
    Copper's Avatar
    Join Date
    Mar 2003
    Location
    Hastings NE
    Posts
    2,215
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I am Lutheran. I too am a "recovering Catholic" (a long time ago). I like that term. I studied a few and found a home here. It is not perfect, but none is. That people are not perfect is the point.

    In my job I teach other officers how to survive. You must have a belief system, something to live for. I believe in a loving God and my Family. That's what I go home for.
    I am just like a Super Hero, but without the power or motivation.................and the funky suit.

  8. #16
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Atheist.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 2 of 25 FirstFirst 12345612 ... LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •