User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 5 of 5

Thread: Study break

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Though I'd share

    Though I'd share

    Yucca Do Ping 1714, a cyclosecta form


    An interesting double bloom on P. moranensis x ehlersiae


    D. stolonifera


    N. inermis (with H. nutans in the foreground)




    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    And some more from ABG

    H. minor



    Orchids







    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Wow....beautiful photos Travis. Like that double bloom. Those H. minors are incredible.

    I was kinda hoping the pics would be an Amber update. When are we going to get to see the growth progress of your little seedling?
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Very cool! Those are great pics, thanks for sharing.

    Now back to work!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (PlantAKiss @ April 30 2004,10:02)]I was kinda hoping the pics would be an Amber update. When are we going to get to see the growth progress of your little seedling?
    I'll see about getting some of those up here in a bit. The only problem will be wading through the 1000+ photos I have to find just a few really cute ones.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •