User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 2 FirstFirst 12
Results 9 to 15 of 15

Thread: Speaking of bugs

  1. #9
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]You know, I remember last time there was supposedto be this huge upwelling of periodic cicadas and I made my mother take me to visit my grandma (who is Cruela Deville incarnate) and I never saw a bleeding one. And now you are telling me they are back and here I am stiing in Atlanta GA and I gotta tell you I am again seeing (and hearing) a whole lotta nothing. I just about think these guys are like bigfoot and the lochness monster.
    Of course not. you arnt in the range of most of the cicadias that will be emerging (too far south)
    that makes no logic

  2. #10
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well all the reports say that it is happening all over the east and GA is pretty east [img]http://www.**********.com/iB_html/non-cgi/emoticons/rock.gif[/img]

    And I know we have cicadas because I have seem some of the dog-day type
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #11
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Travis, I'm under the impression that the 17 year cicadas don't live as far south as you....I may be wrong....funny, though, we don't seem to have them here in NY, either....Guess I'm going hungry tonight!



    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #12

    Join Date
    Jul 2003
    Location
    central upstate New York
    Posts
    439
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Guess you'll just have to settle for pizza.
    Yep, someone put up a map of the Brood X range on the other cicada thread & we both miss out - even though we get the more common garden variety cicada. I sure would like to see one of them for real. [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] Aren't they supposed to be in Virginia? [img]http://www.**********.com/iB_html/non-cgi/emoticons/rock.gif[/img] Anyone around here seen them in real life?
    Restore our biosphere, create a new culture of kindness.

  5. #13
    SirKristoff is a poopiehead Ozzy's Avatar
    Join Date
    Jul 2001
    Location
    Greenswamp, NC
    Posts
    13,747
    Mentioned
    3 Post(s)
    Tagged
    0 Thread(s)
    I saw them once in 98. I was moving my (now) wife to NC and we were driving down I-77 south of Akron. They were everywhere. We had to turn the windshield wipers on. If you saw all the guts on our windshield I don't think you would ever think about eanting them.

  6. #14
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    im not saying you wont have cicadas, but by far bulk will be in the mid atlantic states. Brood x doesnt occur in great numbers in most southern states.
    that makes no logic

  7. #15

    Join Date
    Nov 2003
    Location
    Singapore
    Posts
    1,453
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (0zzy @ May 18 2004,8:58)]I saw them once in 98. I was moving my (now) wife to NC and we were driving down I-77 south of Akron. They were everywhere. We had to turn the windshield wipers on. If you saw all the guts on our windshield I don't think you would ever think about eanting them.
    [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_t_32.gif[/img]

Page 2 of 2 FirstFirst 12

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •