User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 15

Thread: Speaking of bugs

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You know, I remember last time there was supposedto be this huge upwelling of periodic cicadas and I made my mother take me to visit my grandma (who is Cruela Deville incarnate) and I never saw a bleeding one. And now you are telling me they are back and here I am stiing in Atlanta GA and I gotta tell you I am again seeing (and hearing) a whole lotta nothing. I just about think these guys are like bigfoot and the lochness monster.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    SirKristoff is a poopiehead Ozzy's Avatar
    Join Date
    Jul 2001
    Location
    Greenswamp, NC
    Posts
    13,747
    Mentioned
    3 Post(s)
    Tagged
    0 Thread(s)
    That would explain what happened to Jimmie Kimel. He must have eat too many cicadas.

    Maybe they'll be eating them tonight on Fear Factor. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img]

  4. #4

    Join Date
    Mar 2004
    Location
    San Jose, California, USA
    Posts
    50
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Poor guy.

    I did eat some grasshoppers not too long ago. They from one part of Mexico, where apparently they are a snack food.
    Someone brought them into work - so I took some home.
    They weren't bad. Actually pretty good with some beer. Thought my son would try one, but couldn't get him or my wife to go for it.

  5. #5

    Join Date
    May 2004
    Posts
    14
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Talking

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/rock.gif[/img] I think I'll leave the bugs for my plants...

  6. #6

    Join Date
    Mar 2004
    Location
    San Jose, California, USA
    Posts
    50
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well, I draw the line at grubs.
    I don't think I'd want to eat one of those.
    I'd have to be pretty hungry.

  7. #7

    Join Date
    Jul 2003
    Location
    central upstate New York
    Posts
    439
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    oh, for goodnes sake! Cicada-licious, indeed! [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]
    Restore our biosphere, create a new culture of kindness.

  8. #8

    Join Date
    Jun 2003
    Location
    DFW
    Posts
    217
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    yeah.... none for me... i'll stick to loving my VW bugs.
    Driver Found

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •