User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 10

Thread: As promised

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well it took me a bit because I am lazy and have had way too much going on but here are the promised pics of my daughter, Amber.













    And remember folks, you have to start them young (and I'll be nice and not out the bloke in the background)

    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i toufgt you had a p8cture of a weed or something
    that makes no logic

  3. #3
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh mi gosh! Look at her! Awww Travis...she's SO cute! And yes she's grown a lot since the last pics I saw of her. I love that one of you and her. lol That little girl will be an expert CPer by the time she's 3!

    Thanks for posting them...she is a real cutie pie!
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    What a cutie!

    Can't wait for mine.....we're 4 days overdue
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Schloaty...I've been wondering! I THOUGHT it was any day now. Remember what I suggested? Have you tried that? lol

    I want to see what a Schloat seedling looks like.

    Travis grows pretty sprouts and I bet you do too.
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  6. #6
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,504
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    Pyro, thanks so much for posting the pics! Very cute indeed... Make sure you bulk up a little bit and get plenty of fighting devices arround the house when she gets older... I'm sure she is gonna be very beautiful and need MUCH protection from "the guys" *scarry music plays....
    Andrew
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  7. #7

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Man is she looking like Daddy or what! LOL!!! She's a sweetie for sure.

    I see Jay looking awestruck at the ABG plants, the lucky dog. I have to come and visit you soon I think.

    Dave,

    At this rate you are going to have a finshed product! Bring on the new Geminiian, watcha waiting for, my birthday on the 5th?
    "Grow More, Share More"

  8. #8

    Join Date
    Mar 2004
    Location
    Alabama
    Posts
    2,503
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    congrats! where are you and her in that pic. of the greenhouse
    Join the CCPS, you wont regret it: http://s4.invisionfree.com/CCPS

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •