User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 10

Thread: As promised

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well it took me a bit because I am lazy and have had way too much going on but here are the promised pics of my daughter, Amber.













    And remember folks, you have to start them young [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img] (and I'll be nice and not out the bloke in the background)

    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i toufgt you had a p8cture of a weed or something
    that makes no logic

  3. #3
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh mi gosh! Look at her! Awww Travis...she's SO cute! And yes she's grown a lot since the last pics I saw of her. I love that one of you and her. lol That little girl will be an expert CPer by the time she's 3!

    Thanks for posting them...she is a real cutie pie! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    What a cutie!

    Can't wait for mine.....we're 4 days overdue [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_k_ani_32.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/mad.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Schloaty...I've been wondering! I THOUGHT it was any day now. Remember what I suggested? Have you tried that? lol

    I want to see what a Schloat seedling looks like. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]

    Travis grows pretty sprouts and I bet you do too.
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  6. #6
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,432
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    Pyro, thanks so much for posting the pics! Very cute indeed... Make sure you bulk up a little bit and get plenty of fighting devices arround the house when she gets older... I'm sure she is gonna be very beautiful and need MUCH protection from "the guys" *scarry music plays....
    Andrew
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  7. #7

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Man is she looking like Daddy or what! LOL!!! She's a sweetie for sure.

    I see Jay looking awestruck at the ABG plants, the lucky dog. I have to come and visit you soon I think.

    Dave,

    At this rate you are going to have a finshed product! Bring on the new Geminiian, watcha waiting for, my birthday on the 5th?
    "Grow More, Share More"

  8. #8

    Join Date
    Mar 2004
    Location
    Alabama
    Posts
    2,503
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    congrats! where are you and her in that pic. of the greenhouse
    Join the CCPS, you wont regret it: http://s4.invisionfree.com/CCPS

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •