User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 3 123 LastLast
Results 1 to 8 of 19

Thread: Here she is!

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Smile

    Hi everyone,
    I only have time to post one pic today. First day back at work, you see. Anyway, here she is! Little Miranda:

    Miranda



    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2

    Join Date
    Oct 2003
    Location
    Michigan
    Posts
    826
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    A Very Cute baby! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]
    I thought you people where \"Plant Geeks\", Look at me Now...

    Growing List-
    http://www.**********.com/cgi-bin....t=17062

  3. #3

    Join Date
    Aug 2002
    Location
    Richmond Hill, Ontario, Canada
    Posts
    340
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Woohoo! Good job Papa Dave (and Mom too)! We'll have to trade techniques on how to keep the 'boys' away.
    [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    DOH!

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Cchang,

    Put me on the list too [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]

    Dave,

    She is a cutie for sure. Take lots of pics while you can they grow really fast
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Sweet!!!! Finer than frog hair!
    "Grow More, Share More"

  6. #6

    Join Date
    Mar 2001
    Location
    texas
    Posts
    434
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    What a precious bundle of joy you have!!!
    The opinions expressed here are not necessarily those of the management. And the management will be happy to hear that!

  7. #7
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Awwwwwwww...that's a very "fresh" baby there! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] She's a sweetie!

    And YAY...lots of GIRL babies! Maybe that means in another decade or so, we'll have more FEMALE CPers in the hobby.

    Can't wait to see more seedling photos.

    Y'all make good babies...when is the next one?? hehe [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  8. #8

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Very cute indeed! Thanks for sharing. [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

Page 1 of 3 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •