User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 12

Thread: Rain can be bad for cps

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well thanks to the hellacious weather last night I get to cross some plants off my growlist. The rain was so heavy and the clouds so thick that at 5pm it was dark as midnight. Wind gusts to 30 blew half of my Sarrs off the deck and an overflowing gutter layed waste to my beautiful and only specimine of Drosophyllum.

    All told I lost the Drosophyllum, 3 of 5 S. minor Okee Giant seedlings the flower stalk and pitchers on S. leucophylla x umlauftiana and almost all the pitchers over 12" in height on my other Sarrs.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Arg. That sucks! I know the feeling, though. I had just put out some plants (thankfully not all of them, and thankfully most were not my treasured cps), and they got turned into ground chuck in a hail storm.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    I can add a different slant to this: We have had several intense storms in the past few weeks. Since I keep most of my plants outside, open tray, some of them have flooded, causing seedlings to float. This wouldn't be so bad except that one tray hold four trays of Drosera seedlings. They floated, migrated, and mixed. I drained the floaters into a new conatiner and now I have "sundew surprise."

  4. #4
    cool85k5's Avatar
    Join Date
    Oct 2003
    Location
    Georgia U.S.A.
    Posts
    1,530
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yeah,I got the same nasty weather as you Pyro.Broke my tallest sarr pichers,flooded my trays.I lost sarr seed I had planted in a pot.I drilled holes in my trays so the water will not fill up but 1" from the bottom. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/mad.gif[/img]


    Jerry

  5. #5
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    ugh! i know the feeling! it's been raining very badly lately, and my sarrs look like the crap that's inside their leaves... it's really upsetting when a brand new leaf gets broken in half by the rain before it gets its first meal...

  6. #6
    War. War never changes. Est's Avatar
    Join Date
    Apr 2004
    Location
    Champaign, IL
    Posts
    3,935
    Mentioned
    3 Post(s)
    Tagged
    1 Thread(s)
    Aww, sorry to hear everyone's misfortune... 4 of my largest Drosera were ravaged by my friends "dog"... I litterally groaned when I read those posts [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img] .
    \(_o)/ ಠ_ಠ
    My Growlist
    NASC Website Come join in on the fun!

  7. #7
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'm sorry to hear that Travis. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_h_32.gif[/img] Plant disasters are always painful. But as everyone learns..."plants come and go". Eventually those plants will return to your collection. But I know that's not much solace now. It sickens the heart to lose what took so long to acquire and grow. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/confused.gif[/img]
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  8. #8

    Join Date
    Jun 2004
    Location
    TN
    Posts
    273
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Sorry to hear about your plant losses, pyro. I lost a d. intermedia to a bad storm about a month ago, and a S. x 'White Sparkler' to EVIL squirrels that have been digging in my bog! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/mad.gif[/img] I know that's not alot compared to what you lost, but my collection is rather small.
    Growlist

    We are perishing for want of wonder, not for want of wonders.
    - G.K. Chesterton

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •