User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 5 of 12 FirstFirst 123456789 ... LastLast
Results 33 to 40 of 95

Thread: Should marijuana be legalized/decriminalized

  1. #33
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Finch ive run across it several places, books, a couple magazine articles and even a show on the history channel.

    Rattler
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  2. #34
    Somewhat Unstable superimposedhope's Avatar
    Join Date
    Feb 2004
    Location
    Where the Slime Live; Where the Slime Breed
    Posts
    1,697
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Copper, I truely love a dark beer. I would love to try some of yours. I unfortunately cannot find my favorite anymore (Murphy's Irish), Guiness is a favorite as well.

    I no longer care for pot. I smoke maybe 1-2 times a year and always regret afterward. It just makes me sleepy and hungry now. The fun is gone!

    Tamlin, unfortunately many things are different than the friendly sharing environment of pot smoking that you probably knew. I used to deal a few things among them pot. It has become very competitive and violent. People get killed over pot deals and if they are lucky they get away with hospitalization sometimes. It is a double edged sword.

    Joe
    \"There is nothing here of interest to any nation, as a matter of fact there is nothing here but humans!\"

  3. #35

    Join Date
    Apr 2004
    Location
    North Carolina
    Posts
    209
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'm really not sure what side of this issue I'm on right now. I have never used it, so I can not speak from that department. I have to say that on the whole, I agree with the course of action and moral arguments of tamlin. However, I completely agree with all of coppers arguments, but not completely with the ideas as far as its legality. Like I said, I've never used it, or been in contact with anyone who has used it, for good or bad. So I can't declare any personal benifits/detriments on its use. It hasn't really affected my life at all. However, I can speak on the issues concerning the morals and rights of its use.
    As copper said, I don't think that it is right to abuse any drug, as it leads to horrible, situations, either violent or devastating in some other way. But if used in a controlled way, and in moderation, it could lead to major benefits, as stated, as a cash crop, among other things. Tamlin's example of denmark was wonderful, and something like it could be adapted here, but slightly more restricted and controlled. Medical, prescription use would be permited by all. I didn't know that, with a permit, you could use/prescribe it here! I think that people have the right to use it, but with restrictions dictating its use. Restrictions such as age, location, amount, etc. Maybe somehow keep a list of users, such as having the people who wanted to use it legally have to register for it, and obtain it only from a few locations. Just an idea. Prices might go down slightly, but as stated, most medications, even if cheap to produce, remain high in price because of supply and demand. They can charge it, so they do. So there's one benefit down.
    Also, tamlin said that maybe there would be less users because of legality. This probably wouldn't be true. Sure, maybe a few people would stop, but most would keep right on going. You might lose some drug dealers, losing bussiness to a legal source, but other than that, not much. The number would probably increase, with the option open now to people who wanted to try, but avoided it for the legal reasons. Another benefit down the drain.
    Even with the problems marijuana's legalization might cause, I think it would be a good idea. My logic is this- The drug isn't physically adicting. People say that if it's mentally addicting, it's just as bad, but it isn't. There are so many less problems if it isn't a drug the body becomes dependant on. IF it was legalized, people who used it in the past would generally turn to the legal method of obtaining it, the obvious choice. This could help to cut down on its abuse, allowing people to keep using it for either medical reasons or for pleasure, bu would limit its use so that there would be less problems, violence and other. It would make it available to a number o people who would enjoy it or be helped by it, as well as helping to slightly cut down on its abuse (not use). It woudn't solve the problems related to drug abuse, or addictions in any form, but people have the right, in general, to choose what they can or cannot do, provided that it doesn't harm others. If it was legalized, it could provide this right in another form, an probably wouldn't cause any more problems. At worst, the gov't get's a new cash crop, it's more widely available for medical reasons, some users are limited to smaller amount of it, and more people use it. I think that if it was accompanied by the appropriate fines and regulations, then nothing would get worse, it would either stay the same, albeit with less arrests, fear, and loss of liberties, or slightly slow down the drugs use, by providing while limiting.
    So I see both sides. It's bad for you, it should be stopped, but it can't be, and it has many benefits. So make it legal. limit its use, and it can't get worse.

    (just my 2 cents)
    Craig

  4. #36
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i couldn't agree more, craig.

  5. #37
    Somewhat Unstable superimposedhope's Avatar
    Join Date
    Feb 2004
    Location
    Where the Slime Live; Where the Slime Breed
    Posts
    1,697
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I do think that any drug problem is the user/abuser's problem. Not the drugs, societies, and most of all I DO NOT beleive in drug and alcohol abuse as a disease. It is a choice that each individual makes.

    However it is unfortunate that people like Copper will not likely ever see the responsible folks enjoying it in the same manner that she may enjoy a cold, on a responsible level.
    On the flip side it is good thing that the morbid side of drug addiction and its addicts will hopefully never been seen by Tamlin or the rest of the peacefull community.

    Joe
    \"There is nothing here of interest to any nation, as a matter of fact there is nothing here but humans!\"

  6. #38
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]I make no bones about it
    Tamlin, PLEASE tell me you meant to do that..... [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_m_32.gif[/img]

    Ok, I didn't read the whole thread (started going cross eyed), so some of these points may have been addressed.

    My personal feeling is that it should be decriminalized. Why? Well, I am a staunch believe in Millian philosophy (as in John Stuart Mill). As long as what I do has no impact on you, you have NO RIGHT to tell me not to do it. Period. Likewise, I should not be punished for the actions of another. The function of the law is NOT to save us from ourselves.
    On the health issues: My choice. If I want to damage my body, not your business. Period. Corollary: I DO NOT have the right to smoke it in front of you if you don't want the health issues associated with second hand smoke.
    On bad behavior some people exhibit: Did I exhibit this behavior? No. I hate going back to the alcohol argument, but there is no question that it can make some people short tempered and violent. I have NEVER in my LIFE seen a stoned person go after someone. They're too busy giggling. Corollary: If you’re caught behind the wheel of a car stoned, you should be prosecuted to the fullest extent of the law. You are endangering others. Period.

    I know many people have had bad experiences with drugs, and therefore are staunchly against legalization. However I was not a part of those bad experiences, nor will I be. Some people used to drink Robitussin to get wacked (yes, the cough syrup, and I don't know if they still do), but that stuff is still available even to minors as over the counter.

    My feeling, in conclusion, is that in and of itself, weed should be legal. Any actions taken by stoned persons (or sober, for that matter), which would otherwise be illegal should be punished.

    As for my personal experience (for without it, what weight would my words have?), I used to use it. I stopped because I wanted to be healthier, and I wanted to set a good example of a healthy lifestyle for the baby we were (at the time) starting to think about having. It's been a while, and I can honestly say I do miss it. If nothing else, it was certainly psychologically therapeutic. However, at this stage in my life it is not the right choice. Perhaps later in my life, when things are different (kid(s?) are gone), I will re-evaluate my personal avoidance. Or maybe I'll run for president instead....Then I'll have to come clean anyway!

    Now, how much control should there be of the stuff? Well, first of all it should have an age restriction (say 21 for the sake of it). I remember being a teen, and most of my friends had the maturity to make the right decision, but I hung out with a certain crowd. Your prevailing high school student did not have the sense of self to say no if pressured. But as an informed adult, I believe I have the right to take this decision into my own hands.



    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  7. #39
    Capslock's Avatar
    Join Date
    May 2003
    Location
    San Francisco, CA
    Posts
    3,088
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'm with Tamlin and Schloaty on this one. Philosophically, I cannot understand the need to control and regulate behavior that has no victim. I live in the city of San Francisco where the homeless problem is out of control. Virtually all of them are drunks or on the crack. I don't know of any of them who are pot smokers. It's just not in the nature of the drug.

    If you go to a Grateful Dead concert, you'll see this in effect. There is a LOT of pot going around, and yet the crowd is as peaceful as can be, to the point of being irritatingly nice, sometimes. However, when I go see the Giants or the A's play, I invariably see fights and arguements in the stands. The reason? Alchohol. I'd sooner take a young child to the Dead show than a baseball game if I want to show him/her role models for behavior.

    But the undiscussed element here is the enormous social costs of criminalizing marijuana. People's lives are ruined every day, not by smoking pot, but by being arrested for it. They lose jobs, homes, and families. And for the rest of us, there's the ridiculous public costs associated with arresting, holding, prosecuting, sometimes defending, judging, and incarcerating pot smokers. That money could go to things like health care and education. But instead it goes to the ever-increasing prison industry. Is that the sort of country we want? One that imprisons before it educates?

    I don't doubt that Copper, who I have total respect for, sees people at their worst, and often sees marijuana there. But I'd submit that nobody beats their wife because of pot. Again, it's just not in the nature of the drug. Alcohol is a far, far more likely culprit in causing violence. Also, pot is a drug, just like alcohol and cigarettes, and TOTALLY INAPPROPRIATE for kids. DON'T DO DRUGS and STAY IN SCHOOL!!!! When you're 18, then you can make whatever silly decisions you want, but until then, do the right thing!

    Prohibition doesn't work, the social costs are too high, the economic costs are too high, and it diverts attention and effort from truly important things. My preference is total legalization. Prohibit use by minors, and tax all commerce, but otherwise, just make it legal.

    Capslock
    Malo Periculosam Libertatem Quam Quietum Servitium

    My photos are copyright-free and public domain

  8. #40
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I am with Copper on this one.

    I don't have the time to go into it but I will say this: to everyone that would try and use the argument that Copper's story is the outlier in the bell curve of life and so should not be used as a basis of decision please pay heed. You can not judge what is and is not relevant to someone else making their own decision and you can not say something is an exception till you have been there yourself. When you live through #### and everything is pain but you survive and make it through to hear someone belittle your experience by saying it is the exception to the rule is a crippling blow. The biggest and worst fight I ever got in in my life was when someone told me that my life experiences were not important and were foolish to build my opinions on because they were the exception to the normal. I have never been so hurt in all my life.

    I am not going to stop anyone from doing what ever it is they are going to do but I will be darned if they in turn think they have the right to condem me for having a different opinoin and stop me from expressing that opinoin.



    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 5 of 12 FirstFirst 123456789 ... LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •