User Tag List

Informational! Informational!:  0
Likes Likes:  0

View Poll Results: Deadliest animal - Here's the poll

Voters
40. You may not vote on this poll
  • Eastern Diamondback

    1 2.50%
  • Eastern Coral Snake

    5 12.50%
  • Cottonmouth

    3 7.50%
  • Eastern Panther

    1 2.50%
  • Earthworm

    9 22.50%
  • Eastern Box Turtle

    8 20.00%
  • American Alligator

    1 2.50%
  • American Crocodile

    1 2.50%
  • Anolis Carolinensis

    5 12.50%
  • Pygmy Rattlesnake

    6 15.00%
Page 5 of 12 FirstFirst 123456789 ... LastLast
Results 33 to 40 of 90

Thread: Deadliest animal

  1. #33
    Copper's Avatar
    Join Date
    Mar 2003
    Location
    Hastings NE
    Posts
    2,215
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    If we are going with death of settlers then I must go with the turtle.

    Even though the coral is most deadly on its own.
    I am just like a Super Hero, but without the power or motivation.................and the funky suit.

  2. #34

    Join Date
    Aug 2003
    Location
    Markham, Ontairo
    Posts
    462
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    ok, i changed my mind. i voted for the cottonmouth, throught the turtle is suspecious [img]http://www.**********.com/iB_html/non-cgi/emoticons/laugh.gif[/img] . Zongyi
    What you want to do is illeagle here in Canada.
    Email does not work! Use PM or yangzongyi@hotmail.com instead.

  3. #35
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pound for pound the most dangerous animal onthe planet is the Amoeba [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #36
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]Pound for pound the most dangerous animal onthe planet is the Amoeba
    Ha! Wonder why that makes me think of the movie "The Bolb?"
    [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_k_ani_32.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #37
    apple rings.. what more can i say? FlytrapGurl's Avatar
    Join Date
    Feb 2002
    Location
    T-ville, Florida
    Posts
    2,619
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Eastern Coral Snake.
    Liquid Plummer
    Warning: Do not reuse the bottle to store beverages.

  6. #38
    IceDragon's Avatar
    Join Date
    Nov 2003
    Location
    SF Bay Area, CA
    Posts
    316
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I thought I would point this out...
    Quote Originally Posted by [b
    Quote[/b] ]scottychaos, like I said before, this animal kills by using poison not disease. So that will rule out mosquitos, ticks, and a few others.
    At any rate salmonella is more of a disease. Not a poison.

  7. #39
    Steve L's Avatar
    Join Date
    Oct 2003
    Location
    Michigan, USA
    Posts
    136
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Earthworm. The wet areas that were first settled are loaded with large earth worms. They were collected and boiled like pasta. The problem is, earthworms have small stiff hairs along
    both sides of the body. These stiff hairs would become very britle when cooked and lodge in the throats of the settlers as they eat, much like fiberglass. Over time the this caused an aleric reaction in the esophagus and prevented the eater from breathing. They suffocate and die. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_k_ani_32.gif[/img]

    Thats my story and I'm sticken to it! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_o_32.gif[/img]

    Steve
    Steve L
    "I'm Lucky enough to get paid to do this!"

  8. #40
    Somewhat Unstable superimposedhope's Avatar
    Join Date
    Feb 2004
    Location
    Where the Slime Live; Where the Slime Breed
    Posts
    1,697
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I say salmonella is a poison. I don't think bacterial action is usually considered a disease.

    Joe
    \"There is nothing here of interest to any nation, as a matter of fact there is nothing here but humans!\"

Page 5 of 12 FirstFirst 123456789 ... LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •