User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 3 123 LastLast
Results 1 to 8 of 24

Thread: Just a bad month all around for me

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yesterday morning (7/15/04) my mother-in-law took our car to Home Depot. Since she figured it would just be a short trip she left the garage door open. My wife and 10 month old daughter were still at home.

    About 10:45 my wife heard noise outside. Initially she thought it was the garbage men but then she realized that it was coming from inside our garage. She went to investigate and when she opened the door she found three young men burglarizing our garage. They had pulled their truck in and were loading it up.

    My wife confronted them calmly, telling them that they really did not want to do what they were doing and that it was foolish and asked them to please stop and give everything back. She says that they were very startled and looked a little scared at having been discovered. The three of them jumped into their truck and pulled away. As they left my wife followed on foot and got the license plate number.

    A report has been filed with the Police Department and they have informed us that they ran the tag number and the truck is not stolen so it is very likely that the owner of the truck or someone they know was involved in the burglary.

    Some people really suck
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ugh. That stinks. Sorry, man! I hope the didn't get anything too valuable. I'd really give it to your mother in law! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/mad.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    People like that make good fertilizer. That's about the extent of their usefullness. May they realize their full potential in the most timely way possible.
    "Grow More, Share More"

  4. #4

    Join Date
    Nov 2002
    Location
    Hampshire  UK
    Posts
    572
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Tamlin
    There sure sre Vermin about should of locked the door and gassed um >;-D
    Schloaty= Im not sure if giving it to Tamlins mother in law is the answer but its a thought >;-D (English humour)

    Bye for now Julian

  5. #5

    Join Date
    Jul 2004
    Location
    The Netherlands
    Posts
    174
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ouch what a nerve they got.

    My parents were once robbed while laying next to a swimming pool (face down). The robber simply opened the handbag next to them. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_k_ani_32.gif[/img]
    [img]http://home.**********.com/users/phyrex/phyrex.gif[/img]

  6. #6
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    chesara,

    I think you meant PYRO'S mother in law?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  7. #7
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Lost about $400 in tools and such. A compressos, some drills, a bit set, and air hammer, a heat gun, a shop vac, and a boom box. Claire (my wife) caught them right at the start of their raid I think. It is just material stuff and the important thing is that my wife and baby are okay. But I do agree with Tamlin on this, I hope they fertilize the earth to the fullest extent.

    Dave,

    Not really my mom-in-law's fault, I have done the same thing myself. Not anymore however!
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #8

    Join Date
    Nov 2002
    Location
    Hampshire  UK
    Posts
    572
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Schloaty
    Yes your right,im blind

    Bye Julian

Page 1 of 3 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •