User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 8 12345 ... LastLast
Results 1 to 8 of 60

Thread: For the presidencial fense sitters...

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs up

    Found this sight:
    presidentmatch

    Really cool. It gives you a (supposedly) non-biased comparisson of the candidates, and, if you use the Q&A sections, will actually rate you on how much you agree with the various candidates. Really cool!
    My numbers came out (percent is in how much you agree)

    Kerry: 66%
    Kucinich: 61% (don't even know who this guy is, lol)
    Bush: 25% (yikes!)
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Kucinich-74%
    Kerry-69%
    Bush-23%

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Kerry: 66%
    Kucinich: 49%
    Bush: 41%
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4

    Join Date
    May 2004
    Location
    United Kingdom (Bristol, England) I am orriginnally from Mostar, Bosnia(one of the countries of former yugoslavia)
    Posts
    2,160
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Kerry-77%
    Kucinich-70%
    Bush-23%
    Carnivorous plants growlist:http://www.**********.com/cgi-bin....t=17597
    Onda je sultan pao mrtav do kostura

  5. #5
    Jeremiah Harris's Avatar
    Join Date
    May 2002
    Location
    Colorado Springs
    Posts
    1,239
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Bush-62%
    Kerry-37%
    Kucinich-26%

    Very neat web site thanks for sharing.


    thanks
    -Jeremiah-

  6. #6

    Join Date
    Mar 2004
    Location
    Alabama
    Posts
    2,503
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Bush- 63%
    Kerry- 23%
    Other guy - 30%
    Join the CCPS, you wont regret it: http://s4.invisionfree.com/CCPS

  7. #7
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Kerry - 81%
    Kucinich - 77%
    Bush - 14% ( lol )

    That was pretty cool! Thanks Dave. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  8. #8
    Capslock's Avatar
    Join Date
    May 2003
    Location
    San Francisco, CA
    Posts
    3,088
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Kucinich 89%
    Kerry 81%
    Bush 4%

    Wow, I'm a lefty!

    Capslock
    Malo Periculosam Libertatem Quam Quietum Servitium

    My photos are copyright-free and public domain

Page 1 of 8 12345 ... LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •