User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 12

Thread: Speaking of bad weather

  1. #1

    Join Date
    Apr 2004
    Location
    Kissimmee Florida
    Posts
    297
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Don't plan your vacation to Florida for the next couple days. We're currently sandwiched between Tropical Storm Bonnie and Hurricane Charley. The local forcast is for sustained 50 mph winds and 10-15 inches of rain between tonight and tomorrow night. But at least its not snow! I guess after work I'll make sure the plants are secure and hope the flooding isn't too bad. By the way, right now its sunny and about 90 degrees.

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Get out the rain collecting buckets! You won't have to buy water for a while.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well if current weather here in Atlanta is anything to judge by you will get inundated. Bonnie doesn't hit till 12-3pm and we have had constant rain here all night. It filled the baby pool on my deck which was bone dry!!
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4

    Join Date
    Jun 2002
    Location
    NH (Zone 5)
    Posts
    316
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    These are live cams from florida. The first cam is on the island I used to go to for vacation. it was fun, Not too mention all the bogs we passed when we went there, unfortunately that was before I was into CP's, but I'm going back next April!

    http://www.beachview.com/st_george_is_320.htm

    big waves!

    http://www.beachview.com/panama_city_beach.htm


    the one below is getting hit the worst!
    http://www.beachview.com/agpt640.htm

    go to www.beachview.com to view them all!
    \"Are you suggesting coconuts migrate?\"

    \"If vegans love animals so much, why do they eat all thier food?\" - Brandonk

  5. #5
    Frakkin Toaster Cynic81's Avatar
    Join Date
    Mar 2003
    Location
    Reston, VA
    Posts
    682
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    ACK! NOT AGAIN!!!!!!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_k_ani_32.gif[/img]

    Looks like they're both headed for VA/NC. Bonnie will likely just be a rain event, but Charley (which I'm constantly tempted to call Clyde) good mess up my move0in fairly well [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_h_32.gif[/img]
    The Best Part About Being a Sociopath is Never Having to Say You're Sorry.

  6. #6

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I was planning a vacation durning Labor Day weekend but not sure if my budget will allow me. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_h_32.gif[/img]
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

  7. #7
    SirKristoff is a poopiehead Ozzy's Avatar
    Join Date
    Jul 2001
    Location
    Greenswamp, NC
    Posts
    13,747
    Mentioned
    3 Post(s)
    Tagged
    0 Thread(s)
    In 97 (I think) I was living in NC. We had two hurricanes within a month, one was also named Bonnie, the other was Fran. Fran was a major hurricane, that's a night I'll never forget.
    In 99 we had one tropical storm and two hurricanes. The biggest was Floyd. Floyd was worse than Fran. I think it was the second worse natural disaster in US history. One hurricane is bad but when you have back to back hurricanes it's terrible. Even though these are not strong storms as far as hurricanes are concerned, but the fact that they are moving in the same path within 24 hrs this can become a bad disaster. The first one will come in and drop alot of rain, soften up the ground, the second will come in with the wind and cause alot of trees to be blown down because of the ground was soften up by the first one. The flooding can be very bad with the second storm because of the rain dropped by the first. Both of these storms will pass over my hometown. If you are in the path of these storms please be careful and not underestimate the danger that they can bring. Don't be fooled by the fact that these are class one storms.




  8. #8
    apple rings.. what more can i say? FlytrapGurl's Avatar
    Join Date
    Feb 2002
    Location
    T-ville, Florida
    Posts
    2,619
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Actually, Charley's a class 2.

    We're in Central Florida.. Charley's definitely gonna hit here. We've been watching the weather channel alot. My grandparents went out to stock up on food and stuff just in case we're out of power or water for an extended period of time. We're not expecting to have to evacuate, but it could happen, as the news has now suggested possible 110 mph wind in some areas. I don't look forward to hurricanes, but I'm one of those people who get some sort of slight hint of excitement from stuff like this, so I was actually kind of disappointed to hear that we won't be getting the center of the storm O_O Okay, enough of my wretched mind..

    My mom said that she might be coming over here to stay with us tomorrow if the storm hits as hard as they think it will.

    pond boy, Floyd was that bad? Because I remember it.. I remember that is was almost twice the size of the state, and we boarded up the house and evacuated.. but when we got up near the pandhandle, which is half the state away from Titusville, we were trying to sleep in a store parking lot (which was so impossible it wasn't even funny) and we heard on the radio that our part of the storm weakened and was only harboring maybe 40-60 mph winds, which is nothing for a hurricane, so we drove.. all... the way... back... and we got home about 1 AM. The wind was massive and the rain hurt your skin it blew so hard, but we got into the house and went to bed. I'm not even going to get into the mysterious booming noise I heard that night, which to this day has not been explained. Anyhoo, is wasn't too bad for us.. a tree branch off the cherry tree by the house and wholllllle lotta sticks and leves laying around (looked like genuine springtime autumn chaos!). Irene did more damage. Broke off two branches.

    Schloaty, it rained SO bad the past couple of days, and I had my rain-catching doohinkey (gallon jug with the top 3rd cut off.. SOMEBODY SEND ME A BUCKET! PLEASE!!), and got almost four inches of rain, and then I caught a bunch more during the short, fast, windy, rainy outburst earlier today. Don't know how much... gotta go get it.. hmm.. anyhoo, it's been raining every day for a really long time, and really hard, too, which means the ground is massively saturated, therefore the rain and wind from Charley might fall some oak trees, since they have very shallow roots, plus the ground is like wet sponge now. *sigh* And we have two big oaks in the back. Anyhoo, gotta put my babies in the garage.. might wanna slip the cover over the greenhouse too....

    EDIT: By the way, yesterday I went with my grandparents to go gas up the car last night at around 7 or so, when it was really getting black out with clouds, but not raining yet.. only THE most bizarre thunder I've ever heard in my entire life, honestly. We had only gone about 20 seconds down the road and guess what we saw immediately southwest of us. A genuine tornado funnel forming itself downwards rapidly from the genuine tornado clouds. Heck, we get tornado clouds and sightings almost every day this time of year, but this is the first time I'd ever actually seen one right in front of me. It was going east, which was good news, since our house was north of it, up the road, and there's very little chance a tornado would last long enough to reach where the house was before disappating. Anyhoo, that scared the crap out of me. We turned around and went back to the house. Today they went out again, while I stayed home, and when they came back, they said it must've touched down shortly after we saw it form, and about at the same place, because just ahead of where we turned around, in a heavily "treed" area with a few houses, even closer to the Interstate than we are, there was a whole lotta knocked-down trees and junk. The houses weren't hit, though. My grandfather said he saw on the news last night that some dude that was there at the time of the tornado had a camera and he filmed it and the news played it.

    Well, there's an adrenaline rush to last a week. Next time I see a tornado, I gotta drink a can of Red Bull.. *clears throat*..

    Red Bull gives you wiiings.
    Liquid Plummer
    Warning: Do not reuse the bottle to store beverages.

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •