User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 4 FirstFirst 1234 LastLast
Results 17 to 24 of 25

Thread: Its official

  1. #17

    Join Date
    Jun 2004
    Location
    Texas
    Posts
    46
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    WAY TO GO, PYRO!!!!!!! super-uper-duper congratulations!! A PhD is a big thing and to pass beyond your commitee's expectations....wow!! I may have missed this part, but what are you getting your PhD in??
    Defying Gravity

    \"I will exalt thee, O Lord, for you lift me out of the depths!\" (Psalm 30:1)

    ...Just keep on laughing...

  2. #18
    cool85k5's Avatar
    Join Date
    Oct 2003
    Location
    Georgia U.S.A.
    Posts
    1,530
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thats great news Travis!I hope all goes well for you!


    Jerry

  3. #19

    Join Date
    Mar 2001
    Location
    texas
    Posts
    434
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Fantastic news man!! I wish you all the best!! Take 2 aspirin and call me in the morning, Doc [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

    p.s. There was never a doubt in my mind that you would excel..
    The opinions expressed here are not necessarily those of the management. And the management will be happy to hear that!

  4. #20
    Somewhat Unstable superimposedhope's Avatar
    Join Date
    Feb 2004
    Location
    Where the Slime Live; Where the Slime Breed
    Posts
    1,697
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That is great! Congratulations man

    Joe
    \"There is nothing here of interest to any nation, as a matter of fact there is nothing here but humans!\"

  5. #21
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oops, looks like I was a bit unclear. I am not yet a PhD, this was the qualifying exam. It is what I have to pass to 1) stay in the program and 2) actually be called a PhD candidate reather than a mere graduate student. I still have a couple more years before I'll be doing a thesis defense but passing the qual means I get to stick around for those next couple years.

    Now my real work begins... As soon as I get the bacterial strains I need from the freezer and from some collaboraters.

    And to answer the question that popped up a few times. I am working in bacterial genetics. I specifically am looking at a protein that works to regualte transcription of early stage sporulation genes and how it interacts with one of two different forms of RNA polymerase in the bacteria Bacillus subtilis. (And I am sure that is about as clear as mud to a lot of you.)
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #22
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well...I still think Dr. Pyro sounds mighty fine. So we call you that a little early. Then by the time you get the title, you will be very accustomed to it. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  7. #23

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Woooo! I am glad you are not getting a Ph.D. in Post Hole Digging that is a killer on the back! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img] j/k Wow, you must really be busy with college and a child and the the wife. That right there shows you will do a fabulous job! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

  8. #24
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Corngradulations! thats so awsome! yay
    that makes no logic

Page 3 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •