User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 4 FirstFirst 1234 LastLast
Results 17 to 24 of 25

Thread: Its official

  1. #17

    Join Date
    Jun 2004
    Location
    Texas
    Posts
    46
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    WAY TO GO, PYRO!!!!!!! super-uper-duper congratulations!! A PhD is a big thing and to pass beyond your commitee's expectations....wow!! I may have missed this part, but what are you getting your PhD in??
    Defying Gravity

    \"I will exalt thee, O Lord, for you lift me out of the depths!\" (Psalm 30:1)

    ...Just keep on laughing...

  2. #18
    cool85k5's Avatar
    Join Date
    Oct 2003
    Location
    Georgia U.S.A.
    Posts
    1,530
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thats great news Travis!I hope all goes well for you!


    Jerry

  3. #19

    Join Date
    Mar 2001
    Location
    texas
    Posts
    434
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Fantastic news man!! I wish you all the best!! Take 2 aspirin and call me in the morning, Doc

    p.s. There was never a doubt in my mind that you would excel..
    The opinions expressed here are not necessarily those of the management. And the management will be happy to hear that!

  4. #20
    Somewhat Unstable superimposedhope's Avatar
    Join Date
    Feb 2004
    Location
    Where the Slime Live; Where the Slime Breed
    Posts
    1,697
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That is great! Congratulations man

    Joe
    \"There is nothing here of interest to any nation, as a matter of fact there is nothing here but humans!\"

  5. #21
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oops, looks like I was a bit unclear. I am not yet a PhD, this was the qualifying exam. It is what I have to pass to 1) stay in the program and 2) actually be called a PhD candidate reather than a mere graduate student. I still have a couple more years before I'll be doing a thesis defense but passing the qual means I get to stick around for those next couple years.

    Now my real work begins... As soon as I get the bacterial strains I need from the freezer and from some collaboraters.

    And to answer the question that popped up a few times. I am working in bacterial genetics. I specifically am looking at a protein that works to regualte transcription of early stage sporulation genes and how it interacts with one of two different forms of RNA polymerase in the bacteria Bacillus subtilis. (And I am sure that is about as clear as mud to a lot of you.)
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #22
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well...I still think Dr. Pyro sounds mighty fine. So we call you that a little early. Then by the time you get the title, you will be very accustomed to it.
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  7. #23

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Woooo! I am glad you are not getting a Ph.D. in Post Hole Digging that is a killer on the back! j/k Wow, you must really be busy with college and a child and the the wife. That right there shows you will do a fabulous job!
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

  8. #24
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Corngradulations! thats so awsome! yay
    that makes no logic

Page 3 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •