User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 4 of 5 FirstFirst 12345 LastLast
Results 25 to 32 of 33

Thread: What are you favorite christmas songs?

  1. #25
    Ive got Crabs! NaRnAr's Avatar
    Join Date
    Jul 2008
    Location
    Lakewood, CO
    Posts
    196
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ill have to go with "Sleigh Ride" and any other instrumental, especially the Trans Siberian Orchestra stuff. Otherwise, not much of a fan of xmas music....it kind of stresses me out.

  2. #26
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,121
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    No Presents for Christmas mini-LP by King Diamond, of course. "I'm dreaming of a white... sabbath!"
    Ironically, I got this as a Christmas present from my roommate a long time ago.





    Trans Siberian Orchestra (A.K.A. the metal band Savatage) is good too, in the same vein as Mannheim Steamroller. I prefer TSO's non Xmas album: Beethoven's Last Night which I do always listen to around this time of year so I guess that makes it count. Classical inspired & infused metal music is always good to drive to when it's snowing. Fitting somehow with the falling snow.

  3. #27
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Christmas at Ground Zero
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #28
    Aklys joossa's Avatar
    Join Date
    May 2006
    Location
    Palmdale, CA, USA
    Posts
    2,043
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Any Christmas song by Gene Autry.

    I have an ancient white cassette (must be 20 years old, or more) that has some of his Christmas songs on it and every year I bust it out and play it to death in the car.
    -Joel from Southern California


  5. #29
    Your one and only pest! Ant's Avatar
    Join Date
    Dec 2006
    Location
    massachusetts
    Posts
    1,757
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Grandma got run over by a raindeer can't be beat! (well, until they made a cartoon movie to go with it )

  6. #30
    evergreen's Avatar
    Join Date
    Sep 2008
    Posts
    92
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    pretty paper pretty ribbons - Roy Orbison
    run run rudolph - Chuck Berry
    blue chrismas - Elvis Presely

    all the other main radio tunes just annoy me...

  7. #31
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    I forgot about these two:

    The Hannukah Song - Adam Sandler
    Run Run Rudolph - Chuck Berry
    Mary's Boy Child - Boney M

  8. #32
    --Freedom Czar-- Fryster's Avatar
    Join Date
    Apr 2007
    Location
    z5/6, Lansing, MI
    Posts
    1,010
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I like the traditional standards myself..........

    Angels We Have Heard On High
    Joy To The World
    O Holy Night
    Carol of the Bells
    What Child Is This?
    Holly and the Ivy
    Hark! The Herald Angels Sing
    O Little Town of Bethlehem
    I Saw Three Ships
    Away in a Manger
    O Come, All Ye Faithful
    Good King Wenceslas
    The First Noel
    Rockin' Around the Christmas Tree - Brenda Lee
    Blue Christmas - Elvis
    White Christmas - Bing

Page 4 of 5 FirstFirst 12345 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •