User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 12

Thread: Oh the joys of winter

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs down

    I had to make an emergency trip out of town this weekend and one of the things I forgot to do was double check the heater in my sunroom. Seems while I was out we hit a low of 17F. Got back yesterday and nearly cried. At least 75% of my Mexi-Pings have hard frost damage. A number of Drosera also look a little blasted as do my highland Neps (my 1.5m khasiana looks likea bruised avocado [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_h_32.gif[/img] ) I have a bad feeling that I might lose at least half of these plants and right now I almost feel like throwing in the towel. Oh, and the real greeat part is that I leave tomorrow for 2 weeks so I can not monitor the plants that need it and nurse them through.

    I HATE Winter!!
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2

    Join Date
    Mar 2003
    Posts
    785
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I know how you feel! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/confused.gif[/img] Don't give up on them though! Most of the plants turn out to be hardier than we thought!

  3. #3

    Join Date
    Jul 2001
    Location
    somewhere in NJ
    Posts
    1,230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    yeah winter is a killer on plants. I'm a winter hater as well.

    But don't give up on it.

  4. #4
    Metal King
    Join Date
    Jul 2004
    Location
    St.Catharines, Ontario,Canada
    Posts
    853
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That stinks man, I am really sorry to hear this, why do crummy things have to happen to such good people

    Don't give up, though, man, hopefully you will have a nicer surprise on returning, maybe a bit of stres might have been good for a couple of plants?[img]http://www.**********.com/iB_html/non-cgi/emoticons/new/confused.gif[/img]
    Da Growlist

    "You don't need a license to drive a sandwich"-Spongebob Squarepants

  5. #5
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    ARG! Pyro, that SUCKS! I really hope the spring back to life....As SP says, many of these guys are tough little buggers, and will eventually recover from the shock.

    Last year we lost electricity (and therefore heat) in the old condo on the coldest night of the year....HIT NEGATIVE 35!!!!!!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_k_ani_32.gif[/img] Luckily the plants were tucked away so deep in the basement room, they only experienced about 50 degrees before the electricity came back.



    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  6. #6

    Join Date
    Nov 2004
    Location
    California, LosGatos
    Posts
    559
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Whew, i thought you meant negative 35 in your house! I guess that was outside.

    SunPitcher is right, some of these turn out to be really tough. My N. macrophylla looks like it will pull through after losing almost all of it's growth from heats stress.
    You have just recieved the Amish Computer Virus. Since the Amish don't have computers, it is based on the honor system. So please delete all the files from your computer. Thank you for your cooperation.

  7. #7
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,432
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    Pyro, Sorry to hear that. When you get back from your 2 week deal, let me know what you lost. I have a decent collection of mexi pings... maybe not all the rare ones that you have but i'll share any I have that you need... Plants, leaves... whatever I got. Good luck!
    Andrew
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  8. #8

    Join Date
    Sep 2003
    Location
    SoCal (born in utah)
    Posts
    1,140
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    darn sorry to hear that ...how cold does it get there anywayz btw?

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •