User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 3 123 LastLast
Results 1 to 8 of 18

Thread: Tsunami in Sri Lanka

  1. #1

    Join Date
    Aug 2002
    Posts
    518
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    In response to the many messages we have received this morning, we were not directly affected by the tidal waves in Sri Lanka although two of our staff who live on the coast are not contactable, hopefully only because the phone lines there are down. Of course with a death toll of 4,000 and rising, Sri Lanka is a sad place today. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_h_32.gif[/img]
    Rob Cantley
    Nep Nut in Sri Lanka
    http://www.borneoexotics.com

  2. #2

    Join Date
    Jul 2004
    Location
    New York City
    Posts
    1,706
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    glad you're allright, i hope you can get in contact with them soon!
    They say if you play a Microsoft CD backwards, you hear satanic messages. Thats nothing, cause if you play it forwards, it installs Windows.

  3. #3
    SirKristoff is a poopiehead Ozzy's Avatar
    Join Date
    Jul 2001
    Location
    Greenswamp, NC
    Posts
    13,747
    Mentioned
    3 Post(s)
    Tagged
    0 Thread(s)
    I saw this on the news, it looks like a bad scene. I'm glad that you're ok, I hope the same for your staff.

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I just heard about this today! I really hope your two staff members are ok...And I'm sure glad you're ok!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'm very glad to hear you are ok.

    Is there anyone who knows about Troy Davis?? I have been worried sick since I heard of the tsunami. He is in Bali. I have been out of town and pretty much out of touch with the news in detail so I don't know if Bali was affected. If anyone knows Troy and has any information on his situation, I'd appreciate knowing how he is.

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/confused.gif[/img]
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Rob,

    Glad to hear that you are alright. I hope the recovery is not a trial for you.

    On a related note, has anyone heard from Troy Davis (fatboy on the forums)? Or Charles Clarke for that matter?
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7

    Join Date
    May 2004
    Location
    United Kingdom (Bristol, England) I am orriginnally from Mostar, Bosnia(one of the countries of former yugoslavia)
    Posts
    2,160
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Glad youre O.K! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_m_32.gif[/img]

    I hope Troy is O.K too.
    Carnivorous plants growlist:http://www.**********.com/cgi-bin....t=17597
    Onda je sultan pao mrtav do kostura

  8. #8
    SirKristoff is a poopiehead Ozzy's Avatar
    Join Date
    Jul 2001
    Location
    Greenswamp, NC
    Posts
    13,747
    Mentioned
    3 Post(s)
    Tagged
    0 Thread(s)
    Last I heard, the death toll was 21,900, with thousands still missing. This has got to be one of the worst disasters in human history.

Page 1 of 3 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •