User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 11

Thread: Goin' to atlanta

  1. #1

    Join Date
    Jan 2003
    Posts
    140
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Y'all (Yankee just tryin' to fit in...)

    Going to be in Atlanta Feb 6-10 and wondered if anyone was interested in talking cp's. I'll be attending a Biosafety Conference but should have some free time while there. I'm definitely hoping to see the Atlanta Botanical Garden while there. Anybody have connections as I'd be ecstatic to see their tissue culture lab too.
    Not to forget...Any native Cp's to see in the area?

    Looking forward to being warm and seeing the CP sights.

    My email is: kwmartin@earthlink.net

    Kirk Martin
    Fitchburg, MA

    P.S. Just got back from Tampa and saw the USF cp bog at their botanical garden. Some nice plants in there but definitely in need of some weeding.

  2. #2

    Join Date
    Nov 2004
    Location
    Jacksonville, Florida
    Posts
    2,154
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Email ABG and ask if the Cp people will be working. They alternate days with the Orchid people. No cahnace of getting int he lab but you can see the closed room (You will definatly see it) if you get connections. A bunch of Endangered palnts were growing up when I when there. Pikes Nursery sells a lot of cps. Pikes is all over the place. But you must go to ABG no matter what. I have been twice for a total of 8 hours and have not seen all the cps yet (well studied them individually as I do my own plants).

  3. #3

    Join Date
    Apr 2004
    Location
    Kissimmee Florida
    Posts
    297
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Just so you don't get the wrong impression, the cp bog at USF always looks that way, I don't think anyone ever does much with it.

  4. #4

    Join Date
    Jan 2003
    Posts
    140
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Tre,
    I may only have 4-6 hours on Feb 6th for a reasonably long block of time. Are there any "absolutely must sees" at ABG?
    Anything else of interest to cpphile?

    Thanks,
    Kirk

    BTW: Looks like NECPS will be returning to Black Jungle again in June if you care to make the drive [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]

  5. #5
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Contact Pyro. He has some ins at the ABG. He also lives in the area and might be persuaded to join you if he's not up to his neck in work.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  6. #6

    Join Date
    Nov 2004
    Location
    Jacksonville, Florida
    Posts
    2,154
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Take a walk by the Sarr garden. If you are into Neps definatly go in the two "orchid houses" which are really nep houses. Another Nep haouse is in the conservatory with 5 huge plants (30 inch pots or somthing like that).

  7. #7
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    As Scholaty said, I am in Atl. If the 6th is a weekend (I don't have a calandar handy) I might be able to swing a trip over.

    Trent is correct that you can not enter into the actual TC room, only those working on the plants are allowed in there. But there is a viewing area that lets you see in so...

    I highly recommend the high elevation house with its Neps and Helies. The hot house has a couple nice specimines but there are just bicals and amps and truncatas. The conservatory Trent mentions is just off the desert house and also contains the giant glass Nep sculpture. The plants in there are pretty good looking, a few have mammoth pitchers.

    As far as I know there are not local stands of CPs (none that I have found in the last 4 years at any rate.) There are some Sarr sites a few hours into the country but those are all basically closed off (read: on the land of guys with guns who shoot first and ask questions later.)
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #8
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Also, get ahold of Ron Gagliardo if you can, I got to go into the conservation greenhouse where they had some pretty wicked specimens there. I only missed Pyro by 8 mintues!!!!!!!!!!!

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •