User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 4 FirstFirst 1234 LastLast
Results 9 to 16 of 29

Thread: Where does everyone stand in regards to...

  1. #9

    Join Date
    Apr 2003
    Location
    Cambridge, MA, USA
    Posts
    818
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Okay, let me clarify that vaccinations (against viral diseases) are not the problem (contributing to superstrain selection), or the issue. Most of them have almost no disadvantage and a lot of advantages, which is why many of them are required by law in the USA.

    What i'm referring to are bacterial strains. As has been mentioned, taking antibiotics when a person has a viral infection is pointless, and one of the forms of abuse of antibiotics that i was referring to in the original post.

    Unfortunately there are people who demand antibiotics from the doctor when they have a viral disease e.g. a cold, flu, etc, or take some remaining antibiotics that they never finished up before. These all contribute to the selection of bacterial strains that are immune to the antibiotic in question.

    Flu shots in mild flu years are a life saver for the many people who have a particular susceptibility. That includes the elderly and those with respiratory diseases (asthma). Most epidemiologists agree that we are about due for another virulent flu pandemic like has happened several times in the past. When a flu like that is going around (typically killing thousands), anyone would be foolish not to get a vaccination, assuming the right strain is included in the vaccine.

    But the issue of discussion is bacterial superstrains. One of the problems is that all our antibiotics are based on four or five (last time i heard an authority speak on this) biological mechanisms. That's not a lot of magic bullets to be dodged for an organism that reproduces as fast as a bacterium.
    There's no 'a' in perlite.

    My Growlist
    NECPS.org - New England CP growers unite!

  2. #10

    Join Date
    Aug 2004
    Location
    NC
    Posts
    2,344
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    and it's not just bacteria that are becoming resistant to things to kill them, it's pests becoming immune to insecticides and poisons, etc.
    Talk sense to a fool and he calls you foolish-Euripides
    wikipedia rocks! (except for species info)(CPers-add your vast knowledge of CPs to wikipedia&#33
    A person is smart. People are dumb, panicky, dangerous animals and you know it
    Get all the fools on your side and you can be elected to anything

  3. #11

    Join Date
    Jul 2004
    Location
    New York City
    Posts
    1,706
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Evolution has no repurcusions? Man and i thought apes turning into humans was a big deal. lol [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]
    They say if you play a Microsoft CD backwards, you hear satanic messages. Thats nothing, cause if you play it forwards, it installs Windows.

  4. #12

    Join Date
    Apr 2003
    Location
    Cambridge, MA, USA
    Posts
    818
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Amateur_Expert @ Jan. 22 2005,10:43)]Evolution has no repurcusions? Man and i thought apes turning into humans was a big deal. lol [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]
    Well yeah, depending on what is important...

    Discussing it doesn't: Believing or disbelieving in evolution won't affect the reality, whatever that may be. However, understanding how superstrains develop and an awareness of their presence does have a real effect on our future.

    Another way of looking at it is that the application of antibiotic-imposed selection and mutation (~evolution) to bacteria is what counts, not whether or not there really was a missing link.
    There's no 'a' in perlite.

    My Growlist
    NECPS.org - New England CP growers unite!

  5. #13

    Join Date
    Jul 2004
    Location
    New York City
    Posts
    1,706
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (D muscipula @ Jan. 23 2005,4:26)]
    Quote Originally Posted by [b
    Quote[/b] (Amateur_Expert @ Jan. 22 2005,10:43)]Evolution has no repurcusions? Man and i thought apes turning into humans was a big deal. lol [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]
    Well yeah, depending on what is important...

    Discussing it doesn't: Believing or disbelieving in evolution won't affect the reality, whatever that may be. However, understanding how superstrains develop and an awareness of their presence does have a real effect on our future.

    Another way of looking at it is that the application of antibiotic-imposed selection and mutation (~evolution) to bacteria is what counts, not whether or not there really was a missing link.
    No one said its important, i just wanted to know what everyone thought about evolution, which was the purpose of the thread. Hence "Where does everyone stand" was the topic header.

    It just got totally out of hand.. lol 112 pages!!!!!!
    They say if you play a Microsoft CD backwards, you hear satanic messages. Thats nothing, cause if you play it forwards, it installs Windows.

  6. #14

    Join Date
    Apr 2003
    Location
    Cambridge, MA, USA
    Posts
    818
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yes indeed!

    And as i surmised, an infinitely more urgent, but not (potentially) religiously controversial topic has already more or less died.

    Such a funny species. We're so prone to fight over firmly held convictions even when our species track has a bridge out and no one is at the tiller. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_k_ani_32.gif[/img]
    There's no 'a' in perlite.

    My Growlist
    NECPS.org - New England CP growers unite!

  7. #15
    apple rings.. what more can i say? FlytrapGurl's Avatar
    Join Date
    Feb 2002
    Location
    T-ville, Florida
    Posts
    2,619
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I agree with nep g. on this... the reason why America is always getting sick is because we're so obsessively clean. Ridding ourselves and our evironment of every imaginable germ just deprives our immune systems of that taste of disease it needs to build up a defense against it. This is why France is so healthy... other than pointless butt-washing, they're not all that clean, so they have strong immune systems due to their frequent exosure to germs, therefore it's alot harder for them to get sick. That's how vaccinations work: most of them are actually weakened versions of whatever disease it immunizes you against, and that germ stimulates your immune system to produce antibodies against it, making it virtually impossible for you to get it. That's why I don't wash my hands that often. Even after I handle my leopard gecko.. while it's completely possible I could get Salmonella from him, I still only wash my hands half of the times I handle him, since it's good for my immune system to get a taste of the germ once in a while so it can build up a defense. Obsessive cleanliness is an easy way to disease, because obsessive cleanliness keeps you from ever experiencing germs, therefore making it impossible for your immune system to fight a disease if ever exposed to it. Virtually every sickness you can come down with, not just chickenpox, will never occur again in your body, because, after experiencing it, your immune system knows how to fight it. There are many variations of the common cold or the flu; you are infected with one variation and it never happens again. You may get a cold or the flu again in your life, but it will be a different variation, since new variations are popping up all the time. Households that insist on washing their hands, like, 900 times a day and taking showers when they don't need to take showers get sick at the drop of a hat when they're exposed to germs. But people like me, on the other hand, who aren't hypochondriacs and who aren't obsessed with cleanliness rarely get sick, and when they do, it only lasts a short time.
    Liquid Plummer
    Warning: Do not reuse the bottle to store beverages.

  8. #16
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    A very interesting topic, especially for me considering I am a microbiologist.

    So, my thoughts on the matter. As D. said, superstrains are a fact, these are not some media induced frenzy that we hear about so often about so many minor idiotic things. The many problems creating these beasts are: 1) Not using the full perscription as given. 2) Using antimicrobials when not needed and 3) Commercialization of antimicrobials.

    So let us discuss.

    The first of these is something that can only by taken care of by people perscribed antimicrobials. There is not a lot that any organization can do to make people take all of their medicine. However, I think that with all the anti-smoking and anti-drug commercials out there that maybe someone with half a brain might have the foresight to make a commercial or two on the matter. I predict it will happen some day but not until the superstrains become epidemic rather than sporadic.

    2) This is something I personally think the AMA and FDA need to address. They control the doctors and the dispensation of the drugs so they can darn well shut them down for passing out antimicrobials to the wrong people. It is a real sore spot with me that doctors will pass out drugs that are not needed and I actually got in a verbal fight with the last doctor I went to over this. My only imediate solution is that all people who feel like I do should be vocal about it and should tell doctors 'NO' when they try to perscibe antimicrobials for no good reason. And as a point of clarification, "This will help fight any secondary infectinos while the viral infection resolves itself" is NOT a good reason.

    3) This last one is my biggest pet peeve of all time. The commercialization of antimicrobials is, as has been mentioned, making us a sterile nation. When you arenot perpetually exposed to bacterial (both pathogenic and non-pathogenic) then your immune system gets weak or "naive" as we scientists like to say. The addition of tricolsan to every last product on the market could be the very thing that triggers the superstrain outbreak on a national level. Triclosan is a highly stable molecule so when you use it it stays around and perpetually promotes for seletion to resist it (this is the pepper moths all over again boys and girls.) On top of that, triclosan has a really annoying habit of being a trigger for bacteria to activate other resistance genes. This is most obvious in Pseudomonas which will activate every resistance gene in its genome in responce to contact with triclosan. Now most people think that this does not matter much because Pseudomonas is primrily a opportunist but if your immune system is naive then you offer a good foothold for opportunists. Pseudomonas are also pretty promiscuous so they will share their resistance genes with other bacteria.

    There is not a lot that can be done at this point about commercial antimicrobials. I have written companies and, on the rare occasion some one takes the time to reply, the answer is that there is 'profit in antimicrobials so we'll keep making them thank you very much.' Again, I think the FDA needs to step in but the odds of that happening are as good as the proverbial snowball's.

    About all I can do these days is make myself safe. I refuse to take antibiotics unless I absolutly have to take them and then I take all of them. I never buy any product with triclosan. I lecture my family and friends every chance I get to make them understand. Above all I do my best to not live a sterile life. If there is dirt on my hands I do not freak out and douse myself in bleach. I don't run for cover every time some one sneezes. I don't rush to wash my habds after I shake someone elses. I don't wash my hands after petting the dog or holding my snake. I get vaccinations for the necessary things (and dustin is right here, the flu vac is pointless if you are a health person) and I get them often to keep my immune system up and running. Heck, I even get vaccinations for things I probably won't need, like Yellow fever, because there is a chance for cross protectivity (for example, did you know that St Louis encephalitis vaccine protects agains West Nile? I bet you didn't. It also protects agains LaCrosse encephalitis and a number of others.)

    At the very least I take heart in the fact that the the rise of the superstrains will keep me employed for a long time to come. That might be a morbid way of looking at it but the truth can be morbid sometimes.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 2 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •