User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 12

Thread: Pretty flowers

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My wife shot these the other day at ABG. I thought they were impresive so I figured I'd share.





    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    any chance you know what the top one is? the flower shape looks quite damiliar but its Friday morning and my brains not fuctioning. very cool flower and i think Darla would love it simply cause its a dark purple.
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  3. #3

    Join Date
    Sep 2004
    Location
    Zone 9
    Posts
    455
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]the flower shape looks quite damiliar but its Friday morning and my brains not fuctioning.
    Ah, that explains it! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    the cellist

  4. #4
    Somewhat Unstable superimposedhope's Avatar
    Join Date
    Feb 2004
    Location
    Where the Slime Live; Where the Slime Breed
    Posts
    1,697
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    [img]http://www.**********.com/iB_html/non-cgi/emoticons/laugh.gif[/img]

    I was thinkin the same thing
    Joe
    \"There is nothing here of interest to any nation, as a matter of fact there is nothing here but humans!\"

  5. #5
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    lol see, and yah expect me to remember the name of an orchid genus?[img]http://www.**********.com/iB_html/non-cgi/emoticons/new/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  6. #6
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    lol @ Peter. [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

    Boy they are stunning! The lip ridge on that top one reminds me of a cephalotus. The middle one is a phrag...they are one of my top favorites along with the paphs.

    Thanks for sharing. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  7. #7

    Join Date
    Mar 2004
    Location
    Alabama
    Posts
    2,503
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    dude those are awesome
    Join the CCPS, you wont regret it: http://s4.invisionfree.com/CCPS

  8. #8
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Very nice pictures!
    Exceptional camera-work.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •