User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 4 1234 LastLast
Results 1 to 8 of 30

Thread: Interesting thought on evolution

  1. #1
    Hans Breuer's Avatar
    Join Date
    Oct 2004
    Location
    Taipei, Taiwan
    Posts
    392
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    From Scott Adam's latest newsletter.

    _I_ like it...

    STRANGE THOUGHT OF THE DAY
    ==========================

    Sometimes my brain ties together things that are better left alone. Here are three things I've thought about recently:

    - Microchip designers often embed microscopic messages on the surface of the chip as a way of signing their work.

    - DNA has a lot of "junk" parts that don't seem to have any function.

    - A lot of people think evolution is obviously "designed" by someone.

    I wonder if any cryptographers have looked at that junk DNA to see if it's a message from the designer. I'm guessing that it's a code that says something like, "I am Kaloopah, from the star system Nebulon IV. I have sent this evolution program into space as my eighth grade science project."

    I imagine that a few thousand years from now, when scientists have learned to manipulate DNA, we'll be launching evolution programs into the cosmos, programmed to seek any planet that has the right environment. The rocket will land and spill its primordial goo, programmed with evolutionary preferences such as gender, eyeballs, limbs, mobility, and the urge to sit in cubicles while complaining about coworkers.

    Evolution on that new planet would be programmed to develop over a few billion years to resemble us, obviously, because we're spectacularly vain, so we'd write the DNA program to turn out that way. There'd be no point in going to all that trouble just to create the Giant Chipmunk Planet.

    This doesn't answer the question of who created the original aliens. But I suspect that the only way time can be infinite is if the past connects to the future like some huge Mobius strip-wormhole kind of deal. All you need to make this hypothetical system work is people like us who evolve and create new planets, who in turn evolve and create more new planets, until time loops back to our past and we get created again. In other words, we'd HAVE to evolve to the point where we could create a new planet or else we wouldn't exist in the present. Freaky, huh?

  2. #2

    Join Date
    Feb 2005
    Location
    Houston TX
    Posts
    975
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I think Scott Adams needs to step away from the bong.
    My Grow List

    "We are just an advanced breed of monkeys on a minor planet of a very average star. But we can understand the Universe. That makes us something very special." -- Stephen Hawking

  3. #3
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    LMAO!
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  4. #4

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Great theory, and I have had similar speculations. Your logic is well thought out. Please pass the bong, and keep the mind active with these sorts of thoughts. An idle mind is the Devil's playground, and the Devil's name is Alzheimer!
    "Grow More, Share More"

  5. #5
    endparenthesis's Avatar
    Join Date
    Jun 2004
    Location
    Northern VA
    Posts
    1,262
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    We'd sooner strip a planet of all its existing life and resources, judging from previous experience.

    Still having a somewhat stable ecosystem just a century from now isn't considered by many of us to be "profit"... so I don't know that people will be that interested in planning for infinity. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (endparenthesis @ April 22 2005,12:43)]I don't know that people will be that interested in planning for infinity. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]
    You obviously don't need enough science fiction!!



    There is actually a large body of people who think that space is the way to go, you just never hear about them because the popular media tends to focus on politicians and Michael Jackson and stuff that really does not matter in the least.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7
    endparenthesis's Avatar
    Join Date
    Jun 2004
    Location
    Northern VA
    Posts
    1,262
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have shelves of science fiction... I just don't see people planning a couple billion years ahead. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]

  8. #8

    Join Date
    Aug 2004
    Location
    NC
    Posts
    2,344
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]The rocket will land and spill its primordial goo, programmed with evolutionary preferences such as gender, eyeballs, limbs, mobility, and the urge to sit in cubicles while complaining about coworkers.

    Evolution on that new planet would be programmed to develop over a few billion years to resemble us, obviously, because we're spectacularly vain, so we'd write the DNA program to turn out that way
    obviously he doesn't know much about evolution. it's not evolution if it's already programmed. what ... but... they.... sigh... I'll just shut up.
    Talk sense to a fool and he calls you foolish-Euripides
    wikipedia rocks! (except for species info)(CPers-add your vast knowledge of CPs to wikipedia&#33
    A person is smart. People are dumb, panicky, dangerous animals and you know it
    Get all the fools on your side and you can be elected to anything

Page 1 of 4 1234 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •