User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 7 12345 ... LastLast
Results 1 to 8 of 50

Thread: So, what do you do for a living

  1. #1
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    I work for an environmental laboratory, in the Metals Department, prepping samples for analysis. I also prep & analyze for Mercury. I also work for Home Depot on Saturdays, as a cashier.

    So, are you a student or a stay at home parent or corporate executive or...?

  2. #2

    Join Date
    Jun 2004
    Location
    TN
    Posts
    273
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    student, IT major, probably going into Web Development
    Growlist

    We are perishing for want of wonder, not for want of wonders.
    - G.K. Chesterton

  3. #3
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i work at a weekly newspaper in the middle of nowhere, cirrculation of around 2500. as with any small buisness i do a large number of things. i was originally hired as a press man, to run our 5 different presses and other various equipment in the print shop but as soon as my boss(now my wife) discovered that i had an actual brain unlike the guy i replaced, i got put to work doing lots of other stuff. i also set copy on a limited basis, check and make sure we have all the ads on the pages every week, everyone here is also a photographer at some point. i can run our photo lab: do 1 hour work, photo calanders, photo greeting cards, enlargements ect ect ect. i do a lil bit of everything except write stories.

    in my "free time" i vollenteer for various clubs im apart of: Optimist Club, Elks, and Walleyes Unlimited. who ever says there is nothing to do in this small town is full of crap as i have no free time and only actually am at work 5 days a week most weeks
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  4. #4
    Capslock's Avatar
    Join Date
    May 2003
    Location
    San Francisco, CA
    Posts
    3,088
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I make computer games here:

    Flagship Studios

    Capslock
    Malo Periculosam Libertatem Quam Quietum Servitium

    My photos are copyright-free and public domain

  5. #5
    scottychaos's Avatar
    Join Date
    Aug 2001
    Location
    Western New York, USA
    Posts
    2,970
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I was a photography major in college.
    geography minor.
    (graduated 1992 SUNY New Paltz)
    I did the geography minor because I wanted to study aerial photography and cartography...I was more interested in the scientific side of photography than the artistic side, and graduating with ONLY a photography degree wouldnt have made me able to be much more than a wedding photographer..
    I wanted SCIENCE too!
    actually, if I knew then what I know now, I would have gone to college for Enginnering instead! but im still happy with the way things have turned out..

    my first 5 years out of college were spent working at minilabs and small photogrphy stores.
    (MotoPhoto)
    I also taught a college photography class for 2 semesters, at Corning Community College,
    and I worked in a few pro printing labs, mostly custom-printing wedding photos.

    10 years ago I got a job at Eastman Kodak, and im still there today.
    Im an Image Scientist.
    I work in R&D at Kodak.
    My group works on digital printers and makes the imaging algorithms that power the Kodak "Perfect Touch" system.
    (its basically automatic digital dodge & burn!)
    http://www.kodak.com/eknec....th=1307
    the little demo doesnt really do it justice..it can lighten shadows AND darken highlights at the same time..all automatically, in a fraction of a second..
    its slick!

    its a fun job! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]
    Scot

  6. #6
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I stuff junk mail! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]

    I run a Phillipsburg Master Mailler II and sometimes a Bell & Howell AIM Intelligent inserter. These are machines that insert paper into envelopes (like your 5 page electric and phone bills, bank statements, stock statements, etc.) It' some boring work, a chimp could do this but I get paid decent for it (I've got a decade of experience doing it). The schedule is 12 hour days, 2 on 2 off 2 on 2 off... never the same days off each week but it gives me time to work also at a local toy studio and work on all my own crazy projects and still feel responsible by collecting a steady paycheck.

    At the mailing place we are really only super busy 4 times a year, on the business quarters: January, April, July and October the rest of the time there's not a lot to do since 90% of our jobs are stock/tax related (we don't do catalogs, ads for cable TV or pizza shops, etc just confidential stuff) There's work the other months but it's little bits here and there but we can stay and get paid to draw on scrap paper or read books go just home early I always take the night off if there's nothing to do. I love that! [img]http://www.**********.com/iB_html/non-cgi/emoticons/laugh.gif[/img]

  7. #7

    Join Date
    Feb 2005
    Location
    Houston TX
    Posts
    975
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I started off as a physics grad student, and stopped short of the Ph.D. I instead got an MBA, and spplied my math and computer skills to quantitative finance.

    I now work in the energy industry, designing models that value energy assets.
    My Grow List

    "We are just an advanced breed of monkeys on a minor planet of a very average star. But we can understand the Universe. That makes us something very special." -- Stephen Hawking

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I am studying the interaction of Spo0A with sigmaH-RNA polymerase at the spoIIA locus of Bacillus subtilis.

    I also have side projuect of Spo0A regulation of the skf locus and spoIIG locus.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 1 of 7 12345 ... LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •