User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 23

Thread: Genetics dna on pbshd.  genetically altered plant

  1. #9
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i say engineer away! science is great.

    i think daffodils contain around a third of the genes found in humans (or maybe it's humans contain a third of the genes in daffodils.. or maybe that's the same thing?)

  2. #10

    Join Date
    Aug 2004
    Location
    NC
    Posts
    2,344
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    science IS great, and that is exactly why we should be careful. because science has shown us that messing with nature is 90% of the times bad. almost everything we do in our daily lives is bad for nature, and genetically modifying organisms has a huge potential to be very bad.
    Talk sense to a fool and he calls you foolish-Euripides
    wikipedia rocks! (except for species info)(CPers-add your vast knowledge of CPs to wikipedia&#33
    A person is smart. People are dumb, panicky, dangerous animals and you know it
    Get all the fools on your side and you can be elected to anything

  3. #11

    Join Date
    Dec 2004
    Location
    Everett, WA
    Posts
    60
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    read

    it's not the DNA they share alike being added. it's the ones that are special to that animal, which is why it is gotten from that source.
    -jULIE-
    if i can't dance, it's not my revolution.

  4. #12

    Join Date
    Dec 2004
    Location
    Everett, WA
    Posts
    60
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    also...i am all for science. i am not, however, for unconrtolled and checked science. the testing of "is safe for human consumption?" part of the program fell by the wayside and is continually being delayed and when they do, the findings hidden to the public. GE was introduced into the feilds despit the huge risks, and now if we find out everyone's gonna die soon, there is no way to get rid of the stuff save burning evey last crop and killing every potental pollinator & dispursant. how are you sapposed to stop the wind?
    -jULIE-
    if i can't dance, it's not my revolution.

  5. #13

    Join Date
    Aug 2004
    Location
    NC
    Posts
    2,344
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    lol, of course it's not the genes they have in common, but what I was trying to say is that say the antifreeze gene they insert into strawberries from the polar fish. Many other fish have that gene, and many other organisms have the same gene too.
    Talk sense to a fool and he calls you foolish-Euripides
    wikipedia rocks! (except for species info)(CPers-add your vast knowledge of CPs to wikipedia&#33
    A person is smart. People are dumb, panicky, dangerous animals and you know it
    Get all the fools on your side and you can be elected to anything

  6. #14

    Join Date
    Apr 2002
    Location
    Los Angeles, CA
    Posts
    809
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hmm...a carnivorous cotton plant does remind me of a joke I heard. But I'm not going to say it because there are kids on this forum. Just figure out what rhymes with "venus" in the phrase "venus fly trap" and you'll know the joke. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_m_32.gif[/img] *oh, and any mods can delete this if you think it's in poor taste*
    A flytrap ate my homework!
    -Michelle

  7. #15

    Join Date
    Oct 2004
    Posts
    1,379
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Very good posts pinkerton. I am familiar with some of Seralini's studies.

  8. #16
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Great, next thing I know there are going to be a bunch of Rifkinites here denouncing chimeric organisms. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/confused.gif[/img]

    Before you all go slandering genetic chimeras remember that if it were not for chimerism hemophiliacs would be dying in much greater numbers and contracting HIV at an astronomical rate, diabetics would be forced to use contaminated less than pure non-human insulin and a slew of other diseases would be occuring at higher rates or with worse out comes.

    There are two sides to every argument. It would do everyone more than a bit of good to research both side in detail before taking such a stead fast stance.

    Oh, and for the record, as a scientist I can tell you that few other professions are as checked and controled as science. There are more government agencies telling us what we can and can not do than I care to list.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 2 of 3 FirstFirst 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •