User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 3 FirstFirst 123
Results 17 to 23 of 23

Thread: Genetics dna on pbshd.  genetically altered plant

  1. #17

    Join Date
    Nov 2004
    Location
    Jacksonville, Florida
    Posts
    2,154
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well This should interest you Travis. I was reading some studies (probibly in Nature) that were saying how it is human nature to condemn anything you don't understand. I'd say it explains a lot.

  2. #18
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Treaqum @ July 14 2005,11:03)]Well This should interest you Travis. I was reading some studies (probibly in Nature) that were saying how it is human nature to condemn anything you don't understand. I'd say it explains a lot.
    Indeed it does, indeed it does
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #19

    Join Date
    Aug 2004
    Location
    NC
    Posts
    2,344
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Maybe I should have explained myself better and said that I kind of disapprove of GM food and others, not GMOs in general.
    And yes, maybe there are a lot of restrictions and everything, but they're not perfect. That doesn't mean that bad things don't come out of it. A lot of bad things have come and are still coming out of checked and controlled proffesions like science. I'm not saying it was done on purpose of course, but it's impossible to test everything.
    Talk sense to a fool and he calls you foolish-Euripides
    wikipedia rocks! (except for species info)(CPers-add your vast knowledge of CPs to wikipedia&#33
    A person is smart. People are dumb, panicky, dangerous animals and you know it
    Get all the fools on your side and you can be elected to anything

  4. #20

    Join Date
    Jun 2004
    Location
    Long Island, New York
    Posts
    138
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs up

    Quote Originally Posted by [b
    Quote[/b] (JustLikeAPill @ July 13 2005,1:03)]neato . i wish i had a pic!
    Here ya go: Too bad my caps aren't in HighDef too!

    [img]http://home.**********.com/users/lesliex317537/carniverouscotton.jpg[/img]
    [img]http://home.**********.com/users/lesliex317537/carniverouscotton2.jpg[/img]
    On the right is the regular sickened cotton plant.
    The left is the one that produces protiens that digests insects.

    Jim Watson rules. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]

  5. #21
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (pinkerton @ July 13 2005,7:07)]read

    it's not the DNA they share alike being added. it's the ones that are special to that animal, which is why it is gotten from that source.
    I scanned the article. Normally, I like to joke around and make some reference to Gilligans Island episode about the Castaways eating vegetables that came from experimental seeds - but this isn't funny. Thank you fro bringing it to our attention.

  6. #22

    Join Date
    Aug 2004
    Location
    NC
    Posts
    2,344
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I just wish my cotton plant had as many leaves :-/
    so how exactly does it digest the insects? how does it trap them, etc.?
    Talk sense to a fool and he calls you foolish-Euripides
    wikipedia rocks! (except for species info)(CPers-add your vast knowledge of CPs to wikipedia&#33
    A person is smart. People are dumb, panicky, dangerous animals and you know it
    Get all the fools on your side and you can be elected to anything

  7. #23

    Join Date
    Jun 2004
    Location
    Long Island, New York
    Posts
    138
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I dono, they did not go into details.

Page 3 of 3 FirstFirst 123

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •