User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 15

Thread: Darlas never going to let me live this one down...

  1. #1
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    we live out in the country next to a wheat field. so i have been waging a personal war against mice in our house, needless to say i think the mice are slightly ahead in the fustration count even if my kill tally is higher. we have what im pretty sure are 3 types of mice. the normal house mouse, deer mice and what i believe is a hybrid between the two.

    being a bit of a herper even at 23 im still out flipping boards like a 12 year old looking for snakes and what ever else i can find. actually i was looking for termites last night but thats a whole nother story. anyways i flipped a particular board thats generally always good for finding something interesting. and i find a mommy deer mouse and 5 babies that dont even have their eyes open yet. mommy took off but i desided to sit down and see what would happen. sure enough a minute or two later she comes running back to check on her babies 12 inches from the tip of my shoe. i than proceed to catch her with a handy container, keeping her coraled for the time being. now im at a loss of what to do. so i go get Darla to show her what i found.

    Darla comes out of the house and around back and i show here the cute lil nest made with goose feathers and tell her that mommy is under that cup. i can see the look on Darlas face, that "why did you drage me out here" look. i told her im not sure what to do next. she plops down next to me and says turn mommy loose and see what happens. so i did. mommy takes off but i knew she didnt go far and i tell Darla to watch this. and sure enough not 30 seconds later she comes a running back to check on babies. well now we can tell this particular situation has never happened or occured to mommy mouse as she is at a loss of what to do and spends several minutes checking out the babies and running back and forth. finally she desides to carry of the babies to a new spot under a different board 6 feet away. all this with her babies 8 inches form the tips of our shoes, she hauled 3 of the babies away. than we watched her catch a moth for supper(deer mice are partially insectivorus), and than she hauled the last 2 babies under the other board.

    Darla looked up at me and said that they would all be in the house this winter, i said yep i know.

    she said you could kill them? i said no i just couldnt do it.

    she laughed and said you have "hunted" them with a BB gun in the house, set traps, poisoned them and flushed countless of them and you couldnt just stomp those 5 hich you will probably have to trap poison or shoot this winter? i shrugged and said they were outside and they looked so cute and it was way to interesting of a thing to watch.

    she laughed and said some great white hunter you are and proceeded to make fun of me all night though she agreed it was a pretty cool thing to watch.

    so there, not all us hunters ar sadistic nice guys [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_m_32.gif[/img]
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    wussy.


    [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_m_32.gif[/img]



    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    GOOD for you Rattler!! I know you don't want mice in your house...I get 'em sometimes and I hate it because its pretty much only one way to get rid of them and I have a hard time doing that.

    But that lil' mouse was outdoors living her life like Momma Nature tells her to do and she had innocent, dependent babies. She was on HER natural turf...not yours. Just goes to show how strong the maternal instinct is in animals. She was probably terrified but her desire to protect her babies was stronger than the fear.

    Maybe with any luck, she and her babies will stay out in the field. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]

    Thanks for not killing them.
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  4. #4
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I woulda fed them to some Nepenthes! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Simple solution, being that you are a herper. FEED THEM TO A SNAKE! Problem sloved and it supports the natural order of things [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img] Plus, Darwin says "A mouse that stupid should not perpetuate its genes."
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6

    Join Date
    Jun 2005
    Location
    Lansing, MI, USA
    Posts
    92
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Better solution: Go buy yourself some cans of "shake-away" at http://www.pestproducts.com/coyote_urine.htm. Follow the directions and create a barrier just around your house. The rodents won't come in and you can enjoy them outside where they belong.

    I use this stuff to keep the squirrels from wrecking my yard by "shaking" a border around each flower bed. Slightly over $50 of product (with free shipping) has kept me pest free all summer. It works against the moles and voles that were destroying my surrounding yard too.

    Four cans have lasted me since late May and I still have 1 1/2 cans left! I'll be buying this every year without fail. It's nonpoisonous to pets and humans; leaves no odor; keeps the critters away. What more could I ask for?

    I'll be making nylon stocking "bags" of this stuff to fasten to my mini bog containers next year to keep them out of my bogs.

    I reviewed this product for one of my internet columns three years ago. I won't be WITHOUT it again! and I am a natural born skeptic!!!!!!!!!!
    Diana Pederson
    Michigan
    obsessivegardening.com
    christianreviewer.com
    livingwithcockatiels.com

  7. #7
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Pyro @ Aug. 10 2005,9:02)]Simple solution, being that you are a herper. FEED THEM TO A SNAKE! Problem sloved and it supports the natural order of things [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img] Plus, Darwin says "A mouse that stupid should not perpetuate its genes."
    lol, the fact i put poison out means i do not ever feed a wild caught mouse to my snakes. the snakes are worth to much to risk that.
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  8. #8
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Cockatielmother...you found something that KEEPS SQUIRRELS AWAY??!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_k_ani_32.gif[/img]

    I guess it would cost a fortune to put it around an entire yard...

    Do you know how it works?
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •