User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 5 FirstFirst 12345 LastLast
Results 9 to 16 of 40

Thread: Oninion: two incredebly stupid scientific projects

  1. #9
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Seeing how little we know about black holes as it i have much difficulty saying tahat evena fraction of a second is too short to suck up matter because we dont know. I DID reserch on this and resent trhat it has been suggested that i havent. Hawking isnt always right you know. Hawkings radiation no doubt exists but just assuming it could take care of any black hole we produce is... premature






    Quote Originally Posted by [b
    Quote[/b] ]And as for hydrogen producing algae (and just a quick note, this would not be photosynthesis as that term is specifically for the formation of sugars and oxygen from carbon dioxide and water,) I seriously doubt that it will be a problem. Nature has already shown that metabolic processes that produce sizable amounts of hydrogen as a by product are not very robust so the odds of it escaping and reformatting the environment are pretty slim. Plus, you need very specific conditions for it to happen. Conditions that are not to be found in your every day average lake, stream, pond, ocean, puddle, etc.


    Look, the fact of the matter with the algae is it would be impossible to contain if it got out. The species being engeneerd is a common species found in ponds all over the world. Conditions that are found in your every day average lake, stream, pond, ocean, puddle, etc. The existing species mostly produce oxygen as a product of photosynthesis. Were not talking about harnesing a organism that naturally produces hydrogen in some inhospitibal crack. Wre talking about the scum in a lake or pond or something, things that harness much of the planets oxygen and give off very little hydrogen.


    As for genetic engeneering, worry about the future - geneticly engeneerd super solders. you cant tell me that if they had acess to the tecnology to do that some countries wouldnt.


    OH MY GOD I JUST FIGURED OUT I SPELLED OPINION WRONG...

    great. THAT makes me look like i know what im talking about
    that makes no logic

  2. #10

    Join Date
    Aug 2004
    Location
    NC
    Posts
    2,344
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    About the microblack holes, I'm not really worried about them.
    But I am definately not comfortable with genetic engineering. One cannot predict exactly how the GM organism will impact the environment.
    and i'm SURE that SOMEONE somewhere, someday, would be reckless and not do it right, or actually do something voluntarily to cause harm. It could even be the US government. You know how stupid they can be.
    or why the US govt? other govts. could do it too. like russia I believe? that was experimenting with making bio weapons from uh... smallpox and other horrible diseases.
    I think even if we take all the necessary precausions, for example:
    Quote Originally Posted by [b
    Quote[/b] ]Look, the fact of the matter with the algae is it would be impossible to contain if it got out. The species being engeneerd is a common species found in ponds all over the world.
    What if you modified the algae so say the tiniest amount of some (non toxic) chemical would kill them? then they could only live in labs and if any escaped, they would be easy to kill off or maybe they would automatically die off because the chemical is already present in the environment.
    Know what I mean?
    but people ain't perfect, and many times they're brainless idiots.
    frankly I don't trust people enough to start messing with the very core of life.
    Talk sense to a fool and he calls you foolish-Euripides
    wikipedia rocks! (except for species info)(CPers-add your vast knowledge of CPs to wikipedia&#33
    A person is smart. People are dumb, panicky, dangerous animals and you know it
    Get all the fools on your side and you can be elected to anything

  3. #11
    endparenthesis's Avatar
    Join Date
    Jun 2004
    Location
    Northern VA
    Posts
    1,262
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    They could need a substance not found in nature to survive a la Jurassic Park.

    But life... (Goldblum pause)... finds a way!

  4. #12
    War. War never changes. Est's Avatar
    Join Date
    Apr 2004
    Location
    Champaign, IL
    Posts
    3,935
    Mentioned
    3 Post(s)
    Tagged
    1 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]It's already public domain, many researchers use it on a daily basis, so don't freak out. Genetic engineering is not all about three-eyed fish...Diabetics are thankful for the development of recombinant (that means genetically engineered!) human insulin. Instead of the bovine and swine insulin used before.
    Woops, typo on my part, I meant "had been", not "has been." I know the genome race is over, I've talked with one of the leaders of the public domain team. [img]http://www.**********.com/iB_html/non-cgi/emoticons/laugh.gif[/img]
    \(_o)/ ಠ_ಠ
    My Growlist
    NASC Website Come join in on the fun!

  5. #13

    Join Date
    Aug 2004
    Location
    NC
    Posts
    2,344
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]But life... (Goldblum pause)... finds a way!
    yes, but will we be among the ones who do? and anyway, the sheer number of deaths and extinctions wouldn't be worth it. Sure, you can cut a 200 year old tree like back to less than a foot off the ground and it will grow back, but why do it if you can prevent it?
    or were you saying that the uh... chemical dependent GMOs would find a way to... uh... break from the addiction? lol
    Talk sense to a fool and he calls you foolish-Euripides
    wikipedia rocks! (except for species info)(CPers-add your vast knowledge of CPs to wikipedia&#33
    A person is smart. People are dumb, panicky, dangerous animals and you know it
    Get all the fools on your side and you can be elected to anything

  6. #14
    endparenthesis's Avatar
    Join Date
    Jun 2004
    Location
    Northern VA
    Posts
    1,262
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (TheAlphaWolf @ Sep. 08 2005,7:49)]or were you saying that the uh... chemical dependent GMOs would find a way to... uh... break from the addiction? lol
    That one. It probably wouldn't happen... I just wanted to have a Goldblum moment.

  7. #15
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Finch @ Sep. 08 2005,5:11)]I DID reserch on this and resent that it has been suggested that i havent.
    I don't think I said you did not do any research. I said "cause-heads" in general. I admit it is a tag I apply to a broad number of people but I was not specifically refering to you. If I was specifically refering to you I would have singled you out by name.

    Quote Originally Posted by [b
    Quote[/b] ]Seeing how little we know about black holes as it i have much difficulty saying that even a fraction of a second is too short to suck up matter because we dont know.
    We actually know a lot more about black holes than we do about a great number of things. Like say Great white shark breeding behavior... No, we do not know absolutly without a doubt one hundred percent that that fraction of a second is not too long. But if you want to get technical we don't know absolutly without a doubt one hundred percent on anything for the simple reason that it is not possible. You just can not know every single thing about any one thing. Period.

    Back to the experiment, all the math says that it takes it takes a certain critical mass for a certain minimum time to create a stable black hole, neither of which are acheived by the experiment you are talking about. And no one is saying you have to accept the math but the scientists running the project make the decision. The statistical chance that the detonation of a hydrogen bomb would cause the combustion of all the oxygen in the atmosphere did not stop us from building one and then testing it. And the odds of that happening were orders of magnitude greater than a micro-black hole becoming self-sustaining.

    Quote Originally Posted by [b
    Quote[/b] ]Hawking isnt always right you know. Hawkings radiation no doubt exists but just assuming it could take care of any black hole we produce is... premature
    I never said Hawkin was always right (but I am sure he know a darn sight more than any of us about physics and black holes.) And considering Hawking radiation has "taken care of" naturally occuring black holes that are hundreds, thousands and even billions of time larger than anything we could produce I would feel pretty safe saying it is not premature to accept that the micro-black holes will evaporate in a fraction of a second.

    Quote Originally Posted by [b
    Quote[/b] ]Look, the fact of the matter with the algae is it would be impossible to contain if it got out. The species being engeneerd is a common species found in ponds all over the world. Conditions that are found in your every day average lake, stream, pond, ocean, puddle, etc. The existing species mostly produce oxygen as a product of photosynthesis. Were not talking about harnesing a organism that naturally produces hydrogen in some inhospitibal crack. Wre talking about the scum in a lake or pond or something, things that harness much of the planets oxygen and give off very little hydrogen.
    Whether or not the species itself is common is not the issue. It is the metabolic process that I am talking about. For example, there are a number of organisms that can grow in the abscence of oxygen, that does not mean that they always grow without oxygen though. When there is oxygen present they grow like most "normal" organisms do. When there is not any oxygen then they switch metabolic paths to anaerobic respiration. And sure they keep growing, but at a rate that is fractional to that of aerobic respiration. The same thing happens with metabolic processes that produce hydrogen as a by-product. Under normal conditions that you find in your lake, stream, river, whatever, the thing is not going to opt for the hydrogen generating metabolic pathway because there are other, better metabolic pathways it can use. And even if they tweeked it so it had only the hydrogen producing metabolism then the thing would not be able to grow at a rate to maintain itself against competing organisms because the hydrogen producing metabolic pathway is not at all efficient at generating energy for growth. That is one of the main reasons it is stuck in organisms that live in teeny-tiny out of the way cracks where nothing else lives. Because that is the only place an organism with that metabolism can live!!
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #16

    Join Date
    Mar 2002
    Posts
    1,338
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh... I thought this thread was about onions. I like Vidalias.
    There's a tunnel at the end of the light...

Page 2 of 5 FirstFirst 12345 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •