User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 4 of 5 FirstFirst 12345 LastLast
Results 25 to 32 of 40

Thread: Oninion: two incredebly stupid scientific projects

  1. #25
    Let's positive thinking! seedjar's Avatar
    Join Date
    Dec 2004
    Location
    Olympia, Washington
    Posts
    4,064
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Aren't the conditions for making a singularity (mini black hole or whatever you want to call it) pretty well known, within the realm of theory? I think we should be glad that a responsible organization is beginning work with them, because particle accelerators aren't going to be unreasonably expensive for long; eventually someone will get curious and start playing with singularities. It might as well be a reputable body of physicists. Besides, black holes are just very dense particles, so there's no reason to think that they behave any differently from the other heavy hadrons they work with in colliders every day. I think they even shrink when exposed to antimatter.
    The algae is definitely the more worrisome possibility. Algae is ubiquitous - it grows anywhere and everywhere. I think genetics research is important, but I think applied GM technology is foolhardy - our understanding of genetics (and organic chemistry at large) is far too weak to go growing these things out in the wild. It's just too dangerous. Would you breed a race of really big, violent dogs and then turn them loose to live in the wild?
    I once read an article in Wired or Scientific American about the pros and cons of GM crops... part of the 'con' discussion was a story about some field crop, I think it had some shellfish gene for cold resistance, whose genetic modifications 'broke' - IE they would detach from the rest of the cell's chromasomes - and wound up spliced into the chromasomes of a pest that ate the crop in test fields (I think it was grasshoppers.) That idea just creeps me out. I don't want to get some genetic shrimp cooties from my Corn Flakes. The real scary part is now all this stuff is loose in the wild, evolving and competing with the natural world.
    I think a lot of this genetics stuff is just a few decades too soon. In another twenty years or so we'll be able to go put all this stuff on Mars or the moon or some place where it won't be able to kill everybody. In the mean time, there is responsible and viable research to be done in genetics with controlled breeding experiments. Somehow GMs just seem to be in vouge, despite their dangers; probably because anybody with a high school biology lab can do them.
    ~Joe
    o//~ Livin' like a bug ain't easy / My old clothes don't seem to fit me /
    I got little tiny bug feet / I don't really know what bugs eat /
    Don't want no one steppin' on me / Now I'm sympathizin' with fleas /
    Livin' like a bug ain't easy / Livin' like a bug ain't easy... o//~

  2. #26
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ok pyro. its a magazene article in discover magazine and heres the gist of it


    “Some scientists are looking at genetic engineering as a mean s to turn various living organisms into harnessing the sun’s rays and making them into MORE efficient energy producers. Photosynthesis, energy from the sun. Normally, no hydrogenase (a natural enzyme that promotes the formation of gaseous hydrogen) is not involved in the process. But with microbes, it is possible to intervine genetically in ways that... er.. Encourage the activation of hydrogenase . Its not a new metabolic pathway at all.
    The end result would be a altered photosynthedic process that produces LESS oxygen and MORE hydrogen. Researchers at National Renewable Energy Laboratory in Golden, Colorado have already succeeded in converting solar energy directly and continuously into hydrogen by manipulating photosynthesis in Chlamydomonas reinhardtii, a common species of green alge. There are lots of exited companies by the prospect of energy form possible biocells. “


    And with enhanced efficiency, these things could be VERY competitive if they get out.

    As for the black holes, i dont beleive that we know for a fact that they wont suck up matter before evaporating because its all in the relm of hypothesis, not theory.
    that makes no logic

  3. #27
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Finch @ Sep. 14 2005,6:00)]Ok pyro. its a magazene article in discover magazine and heres the gist of it


    .
    Which month? I don't get Discover anymore but I know someone who does. I'd like to read the full thing.

    Also, Discover magazine is not necessarily the most reputable of scientific journals (I am not even soure I would go so far as to call them a scientific journal, more like science tabloid) so you have to take what they publish with a grain of salt. The age old saying I think applies here: "Believe half of what you see and none of what you hear."

    Quote Originally Posted by [b
    Quote[/b] ]“Some scientists are looking at genetic engineering as a means to turn various living organisms into harnessing the sun’s rays and making them into MORE efficient energy producers. Photosynthesis, energy from the sun. Normally, no hydrogenase (a natural enzyme that promotes the formation of gaseous hydrogen) is not involved in the process. But with microbes, it is possible to intervine genetically in ways that... er.. Encourage the activation of hydrogenase . Its not a new metabolic pathway at all. The end result would be a altered photosynthedic process that produces LESS oxygen and MORE hydrogen. Researchers at National Renewable Energy Laboratory in Golden, Colorado have already succeeded in converting solar energy directly and continuously into hydrogen by manipulating photosynthesis in Chlamydomonas reinhardtii, a common species of green alge. There are lots of exited companies by the prospect of energy form possible biocells."

    And with enhanced efficiency, these things could be VERY competitive if they get out.
    Here is, at least in part, the source of the confusion. The efficiency of the process of getting hydrogen from photosynthesis has been enhanced (i.e. the organism are more efficient at producing the energy source, hydrogen.) The organisms themselves do not have enhanced efficiency.

    Do you see the difference?

    Running out basic stoichiometric equations would suggest the organisms would be significantly depressed for growth.

    Basic photosynthesis makes sugar and oxygen from water and carbon dioxide:

    6CO2 + 6H2O --sun--> C6H12O6 + 6O2

    The sugars produced are then used for cellular respiration to create the bulk of energy used for growth.

    Now if you tip the system to make hydrogen the equation looks like this:

    6CO2 + 14H2O --sun--> C6H12O6 + 10O2 + 8H2

    If you balance the equations then you will see that the later process yields less sugar. Sugar that the organism needs for cellular respiration. With less sugar available for cellular respiration the organism will not grow as fast. Hence, it will not be compeditive if it should "get out"

    Quote Originally Posted by [b
    Quote[/b] ]As for the black holes, i dont beleive that we know for a fact that they wont suck up matter before evaporating because its all in the relm of hypothesis, not theory
    It is the process of sucking up matter that accelerates the evaporation of the micro-blackhole. The more it sucks in the faster it evaporates.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #28
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ah i see what you mean now, but i still cant say i like it.


    Interesting. what is a more reputable sorce then>

    Quote Originally Posted by [b
    Quote[/b] ]it is the process of sucking up matter that accelerates the evaporation of the micro-blackhole. The more it sucks in the faster it evaporates.
    And we obviously know so much from studing and testing micro black holes to make such a asshured statement. Most black holes start off far larger than mico black holes. how would we know how things react at this scale with a complete lack of observations on it? And large volumes of matter sucked up into larger black holes more than offsets the incresed evaporation rate, allowing for them to grow larger. Why is this not the case for micro back holes, and how do we know, not having any observations on them? Its in the realm of unteasted theory.
    that makes no logic

  5. #29
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Finch @ Sep. 15 2005,8:39)]Ah i see what you mean now, but i still cant say i like it.
    Never said I was trying to make you like it [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img] Just trying to clear it up that it is less of a bogey man than it was purported to be.

    Quote Originally Posted by [b
    Quote[/b] ]Interesting. what is a more reputable sorce then
    A more reliable source in the popular media... Hmmmm... Scientific American is about the only journal commonly found in the book store that I would call reputable. If you can find Science or Nature or Cell (I occasionally see these in book stores) those would be even better. After that it depends on the field you are looking to learn more on, for microbiology and genetics journals like Journal of Bacteriology and Molecular Microbiology are good bets. PubMed is also a great site for finding real scientific articles. It might sound idioticly obvious but you want something that has articles written as scientific reports (Intro, Mat/Meth, Results, Discussion) and not something with articles written like pop media items.

    Quote Originally Posted by [b
    Quote[/b] ]And we obviously know so much from studing and testing micro black holes to make such a asured statement. Most black holes start off far larger than mico black holes. how would we know how things react at this scale with a complete lack of observations on it? And large volumes of matter sucked up into larger black holes more than offsets the incresed evaporation rate, allowing for them to grow larger. Why is this not the case for micro back holes, and how do we know, not having any observations on them?
    Actually according to theory, most black holes in existence are micro-black holes. This is another case of general public knowledge being impared by the media. Since all the general public really hears about are macro-black holes (i.e. supernovae byproducts) then they assume that that is what the majority of black hole out there are. If you read the scientific literature you will find that macro-black holes are just a small part of the singularity family.

    And macro-black holes behave differently than micro-black holes so their activity cannot really be compared. I am not really one for math so I have not comitted the equations to memory or even really bothered with the fine details of them but it is generally accepted that a black hole has to be a certain minimal mass to be stable, something on the order of a small planet I think. Super colliders of the present don't have the capasity to make something that large.

    Quote Originally Posted by [b
    Quote[/b] ]Its in the realm of unteasted theory
    That is the way it is with most everything. That is what science is about, testing theories. But life is about that too. There is a statistical chance that just by walking out the door I am going to trip and fall on the stair down to my driveway and die from it but I don't let that miniscule chance keep me from ever leaving my house. Every day I test that theory. And I know that might sound somewhat ridiculous but the statistical odds of me dying in my driveway are huge compared to the odds of the black hole going nutso and eating the world for dinner. So if I am willing to risk my life every day then I say let the scientists do what they want to as well. Just my view on life though.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #30
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    IHow do we know micro black holes ecist at all? Arnt they undetected so far? then HOW would w eknow they act differently? becaus ethe models project that it would? There are many things in space science that wasnt what the theorist predicted them to be. Even some current basic theoies need revising because the observations are proving them wrong. Not entierly. But somewhat.

    Oh i've heard about those journals! id absolutely LOVE to have them, but they are expensive. The subscriptions are pretty high.
    that makes no logic

  7. #31
    BANNED
    Join Date
    Feb 2004
    Posts
    883
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Sorry, but I don't have time to read the previous posts. I just wanted to say, that if we create a black hole, it wont really be harmful if it's contained, and it has no possibility of growing in size unless it consumes massive amounts of matter. Even if somehow it dropped to the ground... it shouldn't do too much, as it would be so small, as would its gravitational well. Although, I guess if for some reason it was getting massive amounts of raw energy from something, it could grow in size due to E=mc2 (equivilent exchange of matter and energy). Are black holes spherical? I mean, they should be, shouldn't they?

  8. #32

    Join Date
    Aug 2003
    Location
    Markham, Ontairo
    Posts
    462
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Wouldn't the hydrogen produced rise into the upper atmosphere and get blasted off by solar winds? Zongyi
    What you want to do is illeagle here in Canada.
    Email does not work! Use PM or yangzongyi@hotmail.com instead.

Page 4 of 5 FirstFirst 12345 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •