User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 15 of 29 FirstFirst ... 511121314151617181925 ... LastLast
Results 113 to 120 of 230

Thread: Terrarium Pics

  1. #113

    Join Date
    Oct 2002
    Location
    -
    Posts
    193
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I dont have no idea what size is that!

  2. #114
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    Hey Weser,
    One inch is about 2.5 CM, so can you guess how big the pot is?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #115

    Join Date
    Oct 2002
    Location
    -
    Posts
    193
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I spanned it.......it`s tall 58cm x wide 35cm x high 36cm = 73L = 19.29G. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

  4. #116
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Just because I am feeling argumentative [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]

    Khai said:
    Quote
    I would like to add that you have either a High pressure sodium lamp OR a Metal Halide lamp.
    There is no such thing as a Sodium Halide lamp.[/QUOTE]

    Actually there are Sodium/Halide bulbs. They are made by a company called AgroSun and are wonderful in that they provide a more balanced spectrum, so you get the blue needed for growth and the red needed for flowering.

    As far as the glass vs. paint debate is concerned MrMiller covered most of it in his long post. To sum up, a mirror is ultra reflective or else you could not see yourself in it. The image in a mirror is called a reflection for a reason. I do think I know where your confusion is coming from though Khai

    Khai said:

    Quote
    with a mirror the light is sent through the LEADED glass and then hits a reflective LEADED backer which it then bounces off of and passes once more through the LEADED glass, then it may proceed to you plants leaves.[/QUOTE]

    Your problem was defining the glass as LEADED. Leaded glass dose have absorptive tendancies, but mainly for UV. That is why it is used for houses and cars and such. Your typical mirror however does not need to worry about dealing with UV and so is not leaded.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #117

    Join Date
    Mar 2002
    Posts
    1,338
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I think we're kind of mixing apples and oranges here (sort of). Flat white is an excellent diffuse reflector. It spreads the light evenly in random directions. Mirrors are excellent specular reflectors. They are much different than a flat white surface. Both are good for plants.
    There's a tunnel at the end of the light...

  6. #118
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Dyflam, you make a very good point
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #119

    Join Date
    Jan 2003
    Posts
    390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    hey, I got a question I got a terrarium 1 and a half years ago for x-mas and know I got another one only this one is a 30-35gallon fish tank and I got 2 florisint lights what do I put on top of the fish tank so the flourisint light waves can go throw soo then they will hit the plants because flourisnt lights can go throw plast glass what else should I use to put on top of the tank so the flourist would work for the cps that I have. [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    What is the Propability of the Propability?
    If someone is addictied to therapy how will you treat them?

  8. #120

    Join Date
    Mar 2002
    Posts
    1,338
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Huh? [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]

    I think this answer is appropriate:
    "Phil Traper2 you need some serious work on your grammar, punctuation and spelling! The spelling at least you could take some time to look up words your unsure of how to spell.

    Translation (as best I can figure and trying not to edit it too badly):

    Hey I got a question. I got a terrarium 1 and a half years ago for x-mas. Now I got another one, only this one is a 30-35 gallon fish tank. I also have 2 fluorescent lights. What do I put on top of the fish tank so the fluorescent light waves can go through and hit the plants? (not sure about this last part)
    Fluorescent light can go through plastic and glass, is there something else I should use besides this on top of the tank that would work for the cps that I have?


    I would suggest some plate glass or a piece of plexiglass/acrylic. The glass is cheaper and less likely to sag but also heavier, breakable and if the edges are not smoothed, potentially a great way to cut your fingers. It might even work to just use some plastic food wrap over the top to hold humidity in.
    Tony "



    There's a tunnel at the end of the light...

  9. Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •