User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 2 FirstFirst 12
Results 9 to 11 of 11

Thread: unknown nep

  1. #9
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    hmmmmm....I think you may be right..... That is also quite a common and variable hybrid.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #10
    白人看不懂 Drosera36's Avatar
    Join Date
    Aug 2004
    Location
    z5/6, Rochester, NY
    Posts
    2,017
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Do ya have any spare cuttings

    -Ben
    He who can, does. He who can't, teaches. -George Bernard Shaw
    I love these shirts!!!
    My Growlist
    My Webpage

  3. #11
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    FWIW ABG in more into pure species than hybrids. Plus I never recall having seen a tag for sang x ram in the high elevation house.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •