User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 14

Thread: Unknown Nep

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unknown Nep

    Looking to try and ID this beast for a frined. It is believed it may have originated with Cliff Dodd if that helps any.

    Pitcher





    Different pitcher



    Opening pitcher



    Neck and spur



    Leaf




    I suspect it may be a truncata x veitchii hybrid but it also bears some similarity to the spectabilis x veitchii hybrid.

    Any guesses welcome
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    NECPS President Dave S.'s Avatar
    Join Date
    Jun 2003
    Location
    Northern MA
    Posts
    589
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My guess would be N. spectabilis x N. veitchii.

  3. #3
    A yellow M&M Jefforever's Avatar
    Join Date
    Oct 2006
    Location
    over the rainbow (in the U.S.)
    Posts
    1,637
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hmm....the coloration of the pitcher looks similar to other Spectabilis hybrids, I'd agree with Dave that its probably a spectabilis x veitchii.

  4. #4
    白人看不懂 Drosera36's Avatar
    Join Date
    Aug 2004
    Location
    z5/6, Rochester, NY
    Posts
    2,017
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    This is a very wild guess, but when I saw the picture N. fusca came right into my mind. Could there be some N. fusca in there?

    -Ben
    He who can, does. He who can't, teaches. -George Bernard Shaw
    I love these shirts!!!
    My Growlist
    My Webpage

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Ben, it is possible. Someone else on another forum has suggested burbidgea x fusca...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6

    Join Date
    Oct 2002
    Location
    Lincoln, NE
    Posts
    2,974
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    They thought burbidgea x fusca, with no veitchii at all? Sure looks like a veitchii hybrid.
    Say, on the presitome of the opening pitcher, is that a larva of some kind?

    Cheers,

    Joe

  7. #7
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My vote is N. spectabilis x veitchii. The slightly truncated leaves could be explained by the father. However, if this was the parentage, you'd think it would be more hirsute than the pictures show, wouldn't you?

    The overall shape of the pitcher is very odd, how the pitcher narrows as it gets closer to the peristome. First thing that struck my mind was aristolochioides or ovata DNA in there somewhere, probably not.

    VERY interesting shape.

    Joe, that looks like the very center of the bottom of the peristome is still folded in, and the ribs of the peristome look like the segments of a larvae.

  8. #8
    Doing it wrong until I do it right. xvart's Avatar
    Join Date
    Aug 2006
    Location
    Zone 8
    Posts
    5,594
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Whatever it is, it's awesome. I love the neutral hues.

    xvart.
    "The tragedy of life is not that every man loses; but that he almost wins."

    "Quis custodiet ipsos custodes?"

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •