User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 5 FirstFirst 12345 LastLast
Results 9 to 16 of 33

Thread: Unknown sarracenia

  1. #9

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Also, ([Sarracenia purpurea x flava] x [Sarracenia purpurea x minor])
    the purp x flava is catesbei... so let me rephrase that

    ([Sarracenia x catesbei] x [Sarracenia purpurea x minor])
    OR, it could be:
    ([Sarracenia x catesbei] x Sarracenia minor)

  2. #10

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Take a look.

    I would also want to know how/where else i was "Wrong" [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/rock.gif[/img]http://spectabilis.crosswinds.net/Pics/UNKNOWN.bmp

  3. #11

    Join Date
    Sep 2003
    Location
    SoCal (born in utah)
    Posts
    1,140
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]Spec, I think you're wrong---again
    that was pretty #### mean dude, I mean you can see the windows in the back. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img] . There might be minor in that hybrid sarr.

  4. #12

    Join Date
    Feb 2002
    Location
    menomonie
    Posts
    1,101
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I don't know about you guys, but to me it looks like a purp x leucophylla. I see small windows on both pitchers - small and not very numerous, but they're there. I don't see any minor in it at all. The lid would be smaller and bent over more if there was minor in it. If those small white areas are water drops and not fenestrations, then I would say purp x flava. If they are in fact minute fenestrations, then I'd say purp x leuco.

    Either way, I'm slightly curious as to the coloration. Is this plant grown in full sun? To me, it appears like it is not getting enough light, especially if it's a purp x leuco. If it is in full sun, it is certainly an interesting color form. Where did you get it?

  5. #13

    Join Date
    May 2004
    Posts
    14
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I will put some new pics up later and see if those are windows or just water drops. As for the light its grown in full sun in a bog garden in my back yard. And i *think* i got it at a plant sale a while back at a nature center but im not sure it was a few years back.

    See ya,
    Jerry

  6. #14

    Join Date
    May 2004
    Posts
    14
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well I just ran down and had a look and yes there are windows but thay are very small and scattered if it had Leucophylla in it I'm sure there would be more perhaps (Leucophylla x Flava)x Purpurea? I'm clueless [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]

    See ya,
    Jerry

  7. #15
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Spectabilis73 @ May 18 2004,1:20)][img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] why must you, and a few others, go around and pick on me? [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img]

    Take a closer look. There are windows on the pitchers. HAS to have some kind of minor in it!
    Why must you insist that you are right and everyone else is wrong?

    There are many explainations for the fenestrations on the pitcher that do not include a minor parent. A lecuo could account for that, so could thripe damage. Ostiem said it might have been water but you conviniently ignored that remark (and yes later it turned out that it was not but you were set in your answer before he looked at the plant.) It could be a transposon based mutation that causes some cells to be defective in chloroplast function/expression. There are always alternative answers and ignoring them does not make them go away

    You also ignore some basic genetic principles, like the fact that the minor hood trait is very highly expressed when it is a parent and there is zero indication of that trait in this plant.

    All things being equal I am inclined to believe that this is a purp x leuco form. I have a couple leuco hybrids that exhibit that similar mottled aspect without the full blown white spotting that sometimes occurs. The leuco could also account for the shape of the lip quite easily
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #16

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Exclamation

    Quote Originally Posted by [b
    Quote[/b] (Pyro @ May 18 2004,8:49)]
    Quote Originally Posted by [b
    Quote[/b] (Spectabilis73 @ May 18 2004,1:20)][img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] why must you, and a few others, go around and pick on me? [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img]

    Take a closer look. There are windows on the pitchers. HAS to have some kind of minor in it!
    Why must you insist that you are right and everyone else is wrong?

    There are many explainations for the fenestrations on the pitcher that do not include a minor parent. A lecuo could account for that, so could thripe damage. Ostiem said it might have been water but you conviniently ignored that remark (and yes later it turned out that it was not but you were set in your answer before he looked at the plant.) It could be a transposon based mutation that causes some cells to be defective in chloroplast function/expression. There are always alternative answers and ignoring them does not make them go away

    You also ignore some basic genetic principles, like the fact that the minor hood trait is very highly expressed when it is a parent and there is zero indication of that trait in this plant.

    All things being equal I am inclined to believe that this is a purp x leuco form. I have a couple leuco hybrids that exhibit that similar mottled aspect without the full blown white spotting that sometimes occurs. The leuco could also account for the shape of the lip quite easily
    Quote Originally Posted by [b
    Quote[/b] (Spectabilis73 @ May 18 2004,1:20)][img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] why must you, and a few others, go around and pick on me? [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img]
    That was a joke. I dont know where I am saying I am right and everyone else is wrong... But everyone says I'm wrong without even looking at what I said... I'm just saying, do you see people scream in other peoples faces "You're wrong AGAIN"? No, they get more of a: "Looks like so and so to me, I dont see the so and so that you see in it"
    Maybe this is just a big misunderstanding... I didn't mean any harm with the "being picked on" post, that was just a joke... But I've noticed people take my jokes too seriously these days... Maybe I should just stop with them. I don't know.

    What I'm saying is, people seem to be just as set on me being wrong than actually taking into account what I said. People scream in my face what THEY think. They could just explain it to me, like you did, instead of screaming in my face that I'm wrong.

    Because i knew it wasnt water... But I never took into account the possibility (probability) That it was leuco giving it the windows... You have to remember it was late in the night.

    Theres something in the peristome that makes me think of minor, I'm not sure what it is, It's hard to describe.

    Anyways, taking the leuco in account, I would have to say its:

    ([Sarracenia purpurea x flava] x [Sarracenia purpurea x leucophylla])

    Thats just what I see in it... two parts purpurea, one part flava, and one part leucophylla/minor [img]http://www.**********.com/iB_html/non-cgi/emoticons/laugh.gif[/img]

Page 2 of 5 FirstFirst 12345 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •