User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 3 123 LastLast
Results 1 to 8 of 18

Thread: BOGUS S. leucophylla HCW

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    BOGUS S. leucophylla HCW

    Okay, so some of you may recall the HCW I gave away a few weeks ago. Well I was talking with Barry Rice and John Brittnacher about my plant yesterday and here is what Barry had to say:

    If it were my plant, I'd give it away. Whatever it is, it ain't the advertised article.
    Rather disappointed to hear this as you might imagine.

    How did Barry know it was not the real deal? The bloom was all he needed to make the assertion.

    HCW, while it is a high white plant, has perfectly normal leucophylla blooms.

    So, here are the blooms from two different, perfectly normal leucophylla:




    Note the dark red petals and the maroon sepals

    Here is the bloom off the plant sent to me as HCW:



    A rather drastic difference.

    So, why am I bringing this up (aside from the obvious gripe)?

    This is a very important lesson that I think everyone need to take home. Plants that are "rare" get high value attached to them. And occasionally this leads to someone somewhere deciding to pull a fast one. And then the thing gets perpetuated onto others out of ignorance. If you get your hands on a plant that is supposed to be "rare" then take the time to confirm it and if you discover it is not the real deal then do not keep sending it out with the wrong label!!

    I know who I got my plant from and I know he sent it to me fully believing it was the real deal. I also know who sent him the plant and I am fairly certain they sent it to my source believing it was the real thing as well. I am not going to out anyone because I am not looking to start a galactic finger pointing fiasco.

    Now I do not know who the progenitor of this plant was so I can not follow the progression of possession but if anyone else has a plant labeled as HCW and the blooms look like those of mine then CHANGE THE LABEL NOW!!
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    --Freedom Czar-- Fryster's Avatar
    Join Date
    Apr 2007
    Location
    z5/6, Lansing, MI
    Posts
    1,010
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You bring up some really good points Pyro.

    I had been looking for the HCW just for its white/green pitchers. Heck, I'd settle for a "fake" HCW just as long there wasn't and red pigmentation in its pitchers.

    Nice photos BTW.
    Only a moral and virtuous people are capable of freedom; the more corrupt and vicious a people becomes, the more it has need of masters. -- Benjamin Franklin

  3. #3
    Woodnative's Avatar
    Join Date
    Nov 2004
    Location
    NJ
    Posts
    249
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I didn't know that there was a difference in the flowers. Since my plants are SLOW in NJ, I will have to check that out come bloom time.

    HCL is a population, and there is some variability from plant to plant. Those plants that DO not look like HCW must not be labeled such and culled from the HCW gene pool. I grew a bunch of HCW from the ICPS seedbank. Of the nine or ten or so seedlings, I gave three away to cp beginners just as S. leucos. They were very nice leucos, but had red veining and on one the veining was very coarse. The other six or seven were decent and true to form. I think I traded away three, gave one to a friend, and kept a couple.

    HCW is a beautiful and vigorous plant which should be in everyone's Sarracenia collection! -Chris

  4. #4
    Doing it wrong until I do it right. xvart's Avatar
    Join Date
    Aug 2006
    Location
    Zone 8
    Posts
    5,594
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Good information, Pyro. It's very important to double check all your cultivars, especially on species that it can be more difficult to tell (i.e. Sarracenia, Pinguicula vs. Nepenthes. A good starting place for descriptions, while not comprehensive, is the ICPS Cultivar Registration. I wouldn't even begin to trade my collection away for a rare cultivar unless it was someone I completely trusted; and even then, as Pyro describes, it still may not be correct.

    xvart.
    "The tragedy of life is not that every man loses; but that he almost wins."

    "Quis custodiet ipsos custodes?"

  5. #5
    Moderator Alexis's Avatar
    Join Date
    Sep 2001
    Location
    Manchester, UK
    Posts
    956
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Your plant doesn't look like 'pure' leucophylla either. With the pink tinge in the petals, there's a chance there is some alata in there, although the pitchers may look like typical leucophylla.

  6. #6
    Cardiac Nurse JB_OrchidGuy's Avatar
    Join Date
    Apr 2005
    Location
    SC
    Posts
    3,818
    Mentioned
    2 Post(s)
    Tagged
    0 Thread(s)
    Now I am not sure how cultivars work for CPs, but for orchids when a cultivar is named. The ONLY other plants that can have that cultivar name are ones divided off that plant or clones made from that plant. Seed grown plants ARE NOT that same cultivar even if they look like it. For the simple reason of genetic variation. Just because a plant looks like another does not mean you can slap the cultivar name on it. Since cultivar names are meant to distinguish that one plant for its genetic makeup. Seed grown seeds do not have that genetic makeup even if the mother plant was selfed. I have seen several different cultivars come out of one seed batch since all the siblings look different just like all kids of humand look different from the parents. The same goes for plants. That is why you cannot slap the same cultivar of the mother to seed grown plants that came from that cultivar.

    Woodnative you cannot put the cultivar of HCW on seeds grown from a HCW plant. They are not IMO HCW. Not even to the ones that look like HCW.

    I guess my search for HCW starts again.
    JB
    Friend me on facebook with JB_orchidguy@yahoo.com.
    Growlist Updated 05/08/13

  7. #7
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Alexis View Post
    Your plant doesn't look like 'pure' leucophylla either. With the pink tinge in the petals, there's a chance there is some alata in there, although the pitchers may look like typical leucophylla.
    Yes I suspect that it is probably an alata x leuco back crossed to leuco
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #8
    wmgorum's Avatar
    Join Date
    Mar 2007
    Location
    Little Rock, AR
    Posts
    230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Travis,

    Have you got a shot of the pitchers? Just curious what they look like...

    Will

Page 1 of 3 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •