User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 3 FirstFirst 123
Results 17 to 21 of 21

Thread: Pics from the bog

  1. #17
    Doing it wrong until I do it right. xvart's Avatar
    Join Date
    Aug 2006
    Location
    Zone 8
    Posts
    5,594
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Phenomenal, Pyro. Thanks for sharing. I agree with Phil about the meditation period. It really does bring a relaxing pleasure being amongst my plants; although I don't have a Sarracenia bog, at night I dream of what you describe!

    Quote Originally Posted by Alexis View Post
    What's a DEMACRAT??
    LOL. I've been thinking that everytime I read that signature...

    xvart.
    "The tragedy of life is not that every man loses; but that he almost wins."

    "Quis custodiet ipsos custodes?"

  2. #18
    my soul for CP. duckking's Avatar
    Join Date
    Jun 2007
    Location
    Taiwan,Taipei.
    Posts
    230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Woooo~ Nice shot! Nice plants!
    Thanks for sharing. Excellent!!

    Welcome to Duckking Blog.

  3. #19
    Aklys joossa's Avatar
    Join Date
    May 2006
    Location
    Palmdale, CA, USA
    Posts
    2,043
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Pyro View Post
    Yes I do remember them pinking last year. Those pitchers have only been open 3 days so they have a while before the get full colour. But I really liked the heavy veins and thought it captured the "scaled" look well so I just had to snap the shots
    Please post pictures once they color up.



    BTW, is that the CAAT Box eukaryotic consensus sequence in your sig?
    -Joel from Southern California


  4. #20
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by joossa View Post
    Please post pictures once they color up.
    Will do.

    BTW, is that the CAAT Box eukaryotic consensus sequence in your sig?
    I was wondering how long it would take someone to ask about that LOL. But no, it is not the CAAT box.

    It is DNA sequence but something else entirely. Wonder if anyone can figure it out...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #21
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Some pics from last night.

    RR colouring up









    'Black Widow' all opened up



    And another couple of flava var. rubricorpora x leucophylla blooms


    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 3 of 3 FirstFirst 123

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •