User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 2 FirstFirst 12
Results 9 to 11 of 11

Thread: Sarracenia hybrid characteristics and tendencies

  1. #9

    Join Date
    Jan 2003
    Location
    Atlanta, Georgia (East Atlanta Village)
    Posts
    544
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hybrids? OH MY, the books that could be written. There is no set answer. As one on my mentors once told me, "The Plants don't read the books." This is what makes hybridization so interesting is you NEVER know what you will get, you can only hope. The hope I have for you is that you are patient enough because it is a LONG process even with the short cuts we know. Take good notes and keep good records. There are so many factors that go into it that even in a controlled study you would be hard pressed. Are the parent plant pure breed? Hard to know if there is not a hidden gene in there somewhere from WAY back that might just present it's self. Genetics are a funny and frustrating thing. All I have to say is," Ain't plant sex grand?!" Who is this guru Pyro? I need some new hybrids.
    I remain a man obsessed with a genus
    Brooks

  2. #10
    rco911's Avatar
    Join Date
    Jul 2007
    Location
    3738'N 12229'W
    Posts
    372
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Its crazy...

    I've even known of two non-antho free plants producing an antho free seedling. You NEVER know what you are going to get. Somehow the antho free gene was released in a particular batch of plants. Amazing...

    I just started a new batch of crosses in my own germination chamber. Can't wait to see what they'll bring up. Stay tuned, a nice batch of crosses will be coming in years to come :-)

    Like Brooks says, take good notes and keep good records. You'll be surprised.

  3. #11
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by rco911 View Post
    Its crazy...

    I've even known of two non-antho free plants producing an antho free seedling. You NEVER know what you are going to get.
    Another good point.

    The antho-free gene is recessive so it could very well be floating around in most any plant because a plant that is a carrier looks WT. But put 2 carriers together and out pops an antho-free. Never know what could be lurking in the mix...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 2 of 2 FirstFirst 12

Similar Threads

  1. Sarracenia hybrid questions
    By jrod in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 10
    Last Post: 06-22-2006, 06:08 PM
  2. Sarracenia Purpurea or Hybrid
    By Cindy in forum Identify That Plant!
    Replies: 11
    Last Post: 01-23-2006, 03:07 PM
  3. Unknown Sarracenia hybrid
    By TheCarnifreak in forum Identify That Plant!
    Replies: 18
    Last Post: 01-09-2005, 07:51 PM
  4. Sarracenia hybrid
    By in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 1
    Last Post: 01-11-2003, 05:19 PM
  5. Sarracenia Hybrid Propogation
    By Kaolin235 in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 2
    Last Post: 03-06-2002, 05:00 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •