User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 7 FirstFirst 1234567 LastLast
Results 17 to 24 of 49

Thread: I hate kids

  1. #17

    Join Date
    Jan 2003
    Posts
    390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Trust me the fak cam thing well work it has scared a lot of dumb kids that tryed to steal my nep's when I had them on my porch. Buy a fake cam they are like 15-20 bucks and you won't get into trouble from there parents becuase you shot them. [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    What is the Propability of the Propability?
    If someone is addictied to therapy how will you treat them?

  2. #18
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pryo, I am sorry to hear about that.

    I can tell you what protects me from punks... being on the second story...

    and the fact that every little runt in the complex is scared of me... can't imagine why...

    Hmmm

    6'5" w/ a goatee, weigh 300 (Can almost bench it) and generally enforce the order of the complex by scowling nastily at any kids misbehaving (riding the gates as they open and close, diggin up the complex flower beds). I love well behaved kids, but they seem to be an endangered species.

    A few months ago, I was sick, and studying for a test, my wife was out. I was in a cranky mood and had just got out of the shower and slid some boxers on when I walked out of the bathrrom (naked except for the boxers) and there is this mortified 5 year old little girl standing in my hallway!

    I had left the door unlocked, (because Jenn always comes back from shopping with to much stuff to get her keys and unlock it) and this little girls family had just moved in on the floor above, she thought she was on her floor, and just traipsed right in, and apparently, stood there trying to figure out why all the furniture was changed! LOL. I said "Who are You?" And she screamed and ran out of the house. I follwed her out the door and watched her run up stairs. After getting dressed, I went upstairs and talked to her parents to make sure they knew I wasn't some perv talking to their daughter in shorts...

    any how, not only did the little girl cower in her room, I think even her parents were terrified of me... I am huge, but generally sweet natured...

    ahh welll.. .Pyro, I say tell the cops about what happened, say you overheard some kids talking about growing pot, put two and two together, and maybe the police will come around the neighborhood more, and scare the little buggers..
    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  3. #19
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Travis,

    Oh I blame the kids and the parents don't get me wrong. Unfortunatly I don't know where the parents are so can't go and talk to them. Not that that would do any good mind you, a neighbor got his car trashed by this same group and one of the parents came and yelled at him for discussing the destruction with the kid.

    Schloaty,

    Talk is worthless wioth these kids, I have tried. Every time they are around my apartment I kindly ask them to not be there and not throw rocks into my A/C unit and not peak in my windows.

    Copper,

    Law enforcement is worthless as well, I have reported the kids and their reply was 1) What would you like up to do about it, they are not our kids and 2) We would actually have to catch them in the act and we can't waste an officer to stand watch over your place.

    What I really need is a moat with sharks in it. [img]http://www.**********.com/iB_html/non-cgi/emoticons/alien.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #20
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote
    ....it worked! I became their cool neighbor, so they repect my property because the LIKE me.
    [/QUOTE]
    Well, Pyro, it seems I spoke too soon....
    Yesterday my wife and I spent HOURS on our little patch of garden. As I was returning from dumping the last garbage bag full of debris in the dumpster, I saw one of the kids from the complex run RIGHT THROUGH MY GARDEN. The %^$# kid stomped right on two of my lily bulbs! [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img]
    Now, in the case of this kid, it wasn't malicious (so I didn't drop kick him over the cliff), just a case of not thinking. Never the less, it really peeved me off. Luckily, I caught him red-handed, so I really let him have it with the guilt thing. Almost made him cry (but not quite). Doubt he'll do that again. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #21
    Far too old to grow up now. Kate's Avatar
    Join Date
    Aug 2002
    Location
    Vancouver Island
    Posts
    429
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I really wish I had a solution for everyone, however, as I have been told numerous times by various people, I can't go around systematically exterminating everyone who is a detriment to the human race. So I'm kind of out of suggestions.

    My condolences on the loss of your plants.


    EDIT: Just a quick question that is sort of on the same topic.

    This thought keeps me awake at night:

    My daughter is going to grow up and associate with the children of the people I associated with when I was younger.

    Is anyone else tormented to the point of insomnia by thoughts like this?
    I typo, therefore I edit.

  6. #22
    BoooOOOOooooo!!!!! unknownclown's Avatar
    Join Date
    Aug 2001
    Location
    Edmonds WA
    Posts
    1,501
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Perhaps you should go with the natural look and add some stinging nettles to your gardens [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    The fake cam sounds like a good plan in my opinion.
    As far as the pellet gun, and breaking into the house... Let me tell you people who suggested that you are in for some big fun with an attitude like that. Ive been there done that and let me tell you a vacation behind bars wheather its a county jail or a state prison is something youll remember always. Ahh theres nothing like squatting infront of a celly on an ice cold stainless steel toilet/sink/drinking fountain. Oh how I miss that thing especially in the early morning hours of winter when its the coldest. Oh and sleeping... you cant get enough of that in the 4" 3x6 mattress they provide just remember to show some skin when they come by with the flashlight every hour to count you or they will have to wake you up. It took me months to quit yelling "NICKELL!" when I was woken up after I was released. Ah yeah those were the days no bills to worry about and a part time job that paid 42cents an hour,guess how long you would have to work just to get a bottle of shampoo. People are posted everywhere just waiting to pop doors open for you after ofcourse showing them your DOC tag and reciting your new name...713180(state) or 101856 (county). yours will be different ofcourse than mine [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] Yup I envy you guys you have alot to look forward with attitudes like that [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] Unfortunately I had to grow up and those days are behind me now though [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] I could stand infront of the kitchen for hours with my tray and still nobody is there to serve me the wonderful veggies warmed in the dishwasher cause the stove died.
    Oh one more thing you better invest in some ear plugs if you are light sleepers there usually is alot of screaming after lights out.



    I am the weirdo who sits next to you on the bus!

  7. #23

    Join Date
    Apr 2003
    Location
    Chained to the PetsMart Cashier Counter.
    Posts
    42
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I am VERY sorry to hear that, Pyro. It's why my family and I don't live in apartment complexes anymore.

    I've had little snot-nosed punks steal my bike, punchure its tires, then throw it in the dumpster because it was an "older bike than theirs", and I've had brats who poured ROUND UP in my herbal garden, and worse. I truly feel for you.

    My mom and I tried everything to get those snots taken care of, but one of them was the manager's kid. Nothing like the "Not my angel!" excuse... -_-

    Any case, I could never recover my herbal garden (I work with medicnal plants) and we moved out... Now we live in a house, with a dog to keep watch.

    I'm sorry for what happened, though! I hope that everything turns out right.... I hope your plants are okay.
    "Without carnivores, our planet would be over run with creepy crawlers and very hungry fuzzy things." - Cougarmint, 2003.

    By the way.... I'm a girl!

  8. #24
    It's been one of dem days BigCarnivourKid's Avatar
    Join Date
    Jun 2002
    Location
    I live in Chaffee County, Colorado, USA
    Posts
    3,673
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (RamPuppy @ April 26 2003,5:24)
    6'5" w/ a goatee, weigh 300...........[/QUOTE]
    Sounds kinda like Burl Ives. I always liked Burl Ives [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] .

    For the younger generation..He does the voice of Frosty the Snowman in the Rudolph cartoons they show every Christmas.
    ---Steve Allinger---

    How come chicken fingers are bigger than buffalo wings?

    My Grow List

    Page 3 of 7 FirstFirst 1234567 LastLast

    Similar Threads

    1. new BIG kids..
      By mass in forum Tropical Pitcher Plants  (Nepenthes)
      Replies: 6
      Last Post: 06-09-2010, 03:51 PM
    2. Might try one of these for the kids
      By USMCSKI in forum General Discussions
      Replies: 2
      Last Post: 07-05-2009, 10:29 AM
    3. More of the kids
      By Pyro in forum Reptiles, Amphibians and other terrarium dwelling animals
      Replies: 4
      Last Post: 05-17-2009, 09:59 AM
    4. Who's kids are these?
      By PlantAKiss in forum General Discussions
      Replies: 6
      Last Post: 11-11-2005, 07:31 PM

    Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •