User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 12

Thread: Exploding pitchers

  1. #1

    Join Date
    Jul 2003
    Location
    Philadelphia
    Posts
    277
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I remember someone saying his pitcher plants looked like they exploded.... Well last night I saw Preety big WASp ( Brown one ) inside one and it was like half way in the juice and looked to be struggling... Wellllllllllllllllllll I looked this morning and the pitcher looked EXPLODED !!!!!!!!! I noticed that the wasp returned and was taking pices of that it had cut up and wized away.. I don't know where it took the pices but im gona follow it Or maybe move the Big VFT next to the pitcher and MAYBE WAM Get that bugger.... Little green inchy worm are doing some dasterdly deeds also My cobra's get little sections missing off the top like it was eaten away .. I saw it doing the eatting , so I picked it up and droped it in a sundew heheheh But new ones come by sometimes and feast Should I use insect killer stuff?

    Jiim

  2. #2
    God must have an interesting sense of humor Wesley's Avatar
    Join Date
    Aug 2002
    Location
    Lafayette, IN
    Posts
    1,559
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Here's what I say. KILL the wasp!!!!!!!!! and save the worm. LOL LOL I'm sure you don't want to here this but I LOVE inch worms. They are soooo cool to watch. Sorry. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

    On a serious note. If you can find where the wasp is carring the "pitcher" at night you could spray it with wasp killer. I say at night because if you spray the nest during the day you'll either not get them all or get attacked by an angry mob of wasps.
    For the inch worms, I don't think I've ever seen insect killer for inch worms. So just flick them off and make sure they have no way to get to you plant. Hope this helped.

    Wes
    ~Wes~

    My plants are going green to save the environment

    My Growlist

  3. #3

    Join Date
    Aug 2003
    Posts
    160
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    If you can't find the wasp nest, put the bug killer on the pitchers or some other poison. See what it thinks of that. Maybe you can put sundews around your other plants to keep them safe.

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Matt, no sundew is going to protect you from a wasp! Those suckers are strong!
    I have some insight here for ya. Some species of wasps carry leaf matterial back to their nests and store them. I forget if the leaf itself or the fungus on the rotting leaf becomes food for the wasp larvae, but it's something like that. Kinda like a cicada killer cathes the large cicada as food for it's young.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5

    Join Date
    Sep 2003
    Location
    SoCal (born in utah)
    Posts
    1,140
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You might want to cover your plants with a plastic cover. If you want revenge on the wasps, the next time you see one, kidnap it with some good thick gloves, and dunk them in water till they drown, then put them in a nepenthes pitcher or a really big sundew leaf

  6. #6

    Join Date
    Aug 2002
    Posts
    887
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hello,
    I've had a few wasp chew their way out of pitchers from my darlingtonia and sarracenia. Also, i wouldn't try drowning them, they can stay underwater for like 10 minutes. I'm with the worst luck for all my cp's have 10 large wasp nest above them (i have them next to a large building) and I have wasp every where.
    Kevin
    Kevin Peterson
    Grosse Pointe, MI

  7. #7

    Join Date
    Mar 2003
    Location
    North Central Ohio
    Posts
    394
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    This happened to my s. purp recently. Except i think a grasshopper did the damage since there was one sitting on the pot. I think the grasshopper got inside a pitcher, got stuck and tried to jump several times to get free. This caused the pitcher to break apart and look like it blew out on one side.


    -buckeye

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Katydids did a nice explosion job on my new 'Tarnok' and 'Mardi Gras' pitchers. Really angry about that. But they got good a squashed so I got that going for me
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 1 of 2 12 LastLast

Similar Threads

  1. new pitchers
    By rattler in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 9
    Last Post: 02-09-2009, 09:16 PM
  2. 2 New Nep Pitchers
    By maxposwillo in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 3
    Last Post: 11-14-2007, 02:15 AM
  3. Exploding Plant
    By dzongos in forum Miscellaneous Plants
    Replies: 2
    Last Post: 10-11-2007, 05:59 AM
  4. Why no pitchers?
    By jaxon in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 6
    Last Post: 03-20-2005, 12:39 PM
  5. Exploding pitchers...
    By Vertigo in forum General Discussions
    Replies: 25
    Last Post: 08-09-2003, 04:30 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •