User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 12

Thread: Ant infestation

  1. #1
    God must have an interesting sense of humor Wesley's Avatar
    Join Date
    Aug 2002
    Location
    Lafayette, IN
    Posts
    1,559
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Wink

    I was looking at my pitcher plants and noticed there were tons of ants crawling all over them is that OK? [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]
    ~Wes~

    My plants are going green to save the environment

    My Growlist

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Maybe.

    The ants might be feeding off nectar from your Sarrs but there is also a chance that they are moving in and bringing aphids along. For safety sake I would take the plant in question and fully submerge its pot in water for a few days. That'll kill any ants living in the soil and stop an colinization attempts
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    God must have an interesting sense of humor Wesley's Avatar
    Join Date
    Aug 2002
    Location
    Lafayette, IN
    Posts
    1,559
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My pots are already sitting in water but now the ants seem to have left [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    ~Wes~

    My plants are going green to save the environment

    My Growlist

  4. #4
    It's been one of dem days BigCarnivourKid's Avatar
    Join Date
    Jun 2002
    Location
    I live in Chaffee County, Colorado, USA
    Posts
    3,673
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Keep an eye out for a return of the ants. They could have gone back to the colony to tell them where to find some nice nectar.
    ---Steve Allinger---

    How come chicken fingers are bigger than buffalo wings?

    My Grow List

  5. #5

    Join Date
    Jun 2002
    Location
    United Kingdom Baby!
    Posts
    148
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    #### ants! get a pin and push em' in lol.

  6. #6

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (-VenusAshTrap- @ Sep. 06 2002,7:21)
    #### ants! get a pin and push em' in lol.[/QUOTE]
    Exactly what VenusAshTrap said.

    DIE, DIE, DIE!!!
    travis [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

  7. #7
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Lightbulb

    I am sensing aggression from you two.... [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    Do you need a hug? [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #8

    Join Date
    Aug 2002
    Location
    Canada
    Posts
    409
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    HA! Cute. [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]
    To live we must learn to forgive.

  9. Page 1 of 2 12 LastLast

    Similar Threads

    1. Sundew Infestation!
      By jimscott in forum General Discussions
      Replies: 6
      Last Post: 11-12-2009, 06:51 AM
    2. Spider infestation!
      By dustin in forum Reptiles, Amphibians and other terrarium dwelling animals
      Replies: 5
      Last Post: 12-10-2008, 05:24 PM
    3. infestation
      By Victoria in forum Sundews (Drosera), Byblis, Drosophyllum
      Replies: 15
      Last Post: 02-22-2007, 08:23 PM
    4. Possible Bug Infestation
      By recacho638 in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
      Replies: 3
      Last Post: 10-03-2006, 08:49 PM
    5. Aphid infestation
      By SarraceniaScott in forum General Discussions
      Replies: 19
      Last Post: 06-07-2005, 06:38 AM

    Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •