User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 17

Thread: My opinion on milk

  1. #9
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    BigBalBob,

    what about trying a eyedropper? That is what most people use.

    Everyone else, Martin, Tony,

    I know milk is pasteurized to kill the bacteria in it, have you ever thought of, or do you see any benefits to zapping it in a microwave for about 3o seconds before feedint?

    this may infact, damage the milk and reduce the effectiveness of it's protiens...
    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  2. #10
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Angry

    Hey guys,
    I used some milk with my Flava and my Purpurea, didn't dilute or anything.....They both shot up new, substancially bigger pitchers. Not sure if it was the milk, or something else, but they both did it at the same time so I think it was the milk.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #11
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Has anyone thought about just using a grain or two of powdered milk?

    Just curious

    Pyro
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #12
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I can just see the new Milk Commercials now.

    "Milk, it does a sarracenia good..."

    And a talking Sarracenia Leucophylla with milk on the lip.
    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  5. #13
    It's been one of dem days BigCarnivourKid's Avatar
    Join Date
    Jun 2002
    Location
    I live in Chaffee County, Colorado, USA
    Posts
    3,673
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I don't think zapping milk in the microwave will do any good once it is put in the pitcher it will feed the bacteria in the pitcher.
    ---Steve Allinger---

    How come chicken fingers are bigger than buffalo wings?

    My Grow List

  6. #14

    Join Date
    Feb 2002
    Posts
    432
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'm trying out powdered cheese. The kind you put on your noodles. I'll see if it rots the pitcher.

  7. #15
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    we are a bunch of freaks!

    Sar Flava "Can I have some more protein powder please?"

    Sar Purpera "I would like some Cheese Please..."

    ahh aint science grand!?
    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  8. #16

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Why would you want to give your plants milk...milk is good for your bones...this is not the "Little Shop of Horrors" [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] .

    mn
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

Page 2 of 3 FirstFirst 123 LastLast

Similar Threads

  1. How do you feed milk?
    By Andenes in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 4
    Last Post: 07-13-2003, 11:47 AM
  2. Milk as a fungicide...
    By Spectabilis73 in forum General Discussions
    Replies: 2
    Last Post: 11-05-2002, 11:30 AM
  3. Powdered Milk?
    By Linda in forum General Discussions
    Replies: 3
    Last Post: 07-16-2002, 06:45 AM
  4. pass the milk please
    By shut_Your_trap in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 2
    Last Post: 07-09-2002, 10:27 PM
  5. Milk benificial?
    By FlytrapGurl in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 12
    Last Post: 07-05-2002, 11:22 AM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •