User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 6 of 6

Thread: A technical question

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    So I know that the mass of petals on cultivated roses is a result of a hox gene mutation but I wanted to know if anyone has actually looked to see if that is the same case with this plant? Is there any literature on it?
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    scottychaos's Avatar
    Join Date
    Aug 2001
    Location
    Western New York, USA
    Posts
    2,970
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro,
    to see if *what* is the same?
    what does tarnok do that is similar to the rose?
    I just got some from the ********** sale, so im curious what yu mean!
    thanks,
    scot

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (scottychaos @ Mar. 20 2003,07:45)
    to see if *what* is the same?
    what does tarnok do that is similar to the rose?[/QUOTE]
    To see if a hox mutation is the result of the phenotype.

    Domestic rose blooms look the way they do because of a gene mutation that causes them to form massive numbers of petals (wild roses have only 5 petals.) S. 'Tarnok' also has flowers that have an increased petal number.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4

    Join Date
    Jan 2003
    Posts
    390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    I got a question, is there a sort of dug or chemical to make polyploidy to speed up. Polyploidy make double sets of chromosomes which makes the plants be double or some times 3 sets of chromosomes wich make it grow bigger be healthier and stronger. What is the chemical called to make polypolidy happen a lot and is this alright to use on CP's. [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]
    What is the Propability of the Propability?
    If someone is addictied to therapy how will you treat them?

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Polyploidy does not always make a plant bigger/healthier/stronger. In fact most polyploid offspring of any organism are weak and problematic.

    There are many chemicals that can induce polyploidy but I am not sure if they are safe or easy access enough for basic hobby use.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6

    Join Date
    Feb 2003
    Posts
    55
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    There are numerous chemicals used to induce polyploidy. Probably the most referenced is colchicine, but any chemical that prevents or inhibits the segregation of replicated chromosomes into daughter (divided) cells will work to some extent. I'd agree for most people it would probably be a pain to get your hands on pure powder due to it's toxicity (and I would assume due to its activity carcinogenicity) but you could call up Sigma-Aldrich and ask.

  7. Similar Threads

    1. question
      By M Jacobs in forum Tropical Pitcher Plants  (Nepenthes)
      Replies: 7
      Last Post: 11-30-2009, 08:46 PM
    2. Technical difficulties
      By swords in forum General Discussions
      Replies: 4
      Last Post: 05-17-2005, 07:29 PM
    3. Technical help please...
      By adnedarn in forum General Discussions
      Replies: 17
      Last Post: 06-02-2004, 04:53 AM
    4. Couple of technical questions
      By Linda in forum General Discussions
      Replies: 2
      Last Post: 09-30-2002, 08:10 AM

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •