User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 7 of 7

Thread: What would be better?

  1. #1
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,432
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    I am wondering what would be better for my sarrs. here are the options...
    1) grow room. approx 74-83 degree, 70% humidity, fluorescent lights 4 40watt bulbs (mixture cool, warm and chroma 50)

    or

    2) out side. aprrox 50-85 degree, 15-20% humidity, sun light

    thanks in advance!!
    later,
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  2. #2
    homer's Avatar
    Join Date
    Mar 2003
    Location
    Puyallup, Washington USA
    Posts
    679
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Andrew,

    Do you live in a desert? That humidity is really low... anyway, I would imagine you would need to put the sarr outside later this year (august possibly) in order for them to acclimate to the gradually cooler conditions as fall approaches. You don't want to shock the plants. The other concern of mine would be the amount of light for the sarr inside... I don't know if it would be enough considering the heights of the plants, unless you are growing psittacina.

    Try and put some sarr outside with a water reservoir to keep the humidity up in that local area and grow some inside under the lights and see what you get!

    hope this helps,

    Homer

  3. #3
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,432
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    homer, yes i live in "desert" lands... Tucson, Az. the problem is i don't have many sarrs... so not enough to even use one as a test dummy. right now they are inside. and not very happy about it. but growing never the less...
    later,
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  4. #4
    rubrarubra's Avatar
    Join Date
    Dec 2001
    Location
    Ventura county, southern CA
    Posts
    330
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Andrew, I'm not sure what it is like in Tucson, but I live in southern california and grow my sarracenias outside. During the summer I put a shade structure over them that gives them part shade. They could handle the direct sun, except the pitchers don't last as long before the tops get burned. We get top temperatures in the high nineties, though it occasionally gets over 100 degrees. During the winter we get occasional freezing temperatures during the night and the plants go dormant for about 3 months. Even if the pitchers burn soon after you put the plants outside, they eventually can handle less and less humidity. I haven't tried sarracenia inside, but I know that D. capensis hates growing inside under growlights. Outside they get big and robust and 9" in diameter, while they grow only smaller green leaves inside.
    Peter

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I know that Ram wrote an article on growing in Texas that could probably be applied to Arizona. Check under the plant care link, I think it is called 'Caring for carnivorous plants in the extreme conditions' or something like that
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Rubra,
    How high is your humidity that you can grow D. Capensis outside?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  7. #7

    Join Date
    Jan 2002
    Location
    Southern CA, US
    Posts
    1,058
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I would go with outdoors culture. I have capensis with 5in leaves growing with the tray system at ~30-50% humidity under 70% shade for part of the afternoon. I grow the sarrs outdoors in full sun all day. I have had very minor problems with the tops burning even though the humidity is low.

    15% percent humidity should be fine as long as the plants are kept on a tray. Some shading might be needed in the afternoon.

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •