User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 3 of 3

Thread: seeds.....

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    Hi everyone,
    I sowed a couple of Sar seeds a few days ago, and I was wondering how long they (generally) take to germinate. I asked this question in another thread, but now I can't find it!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img]
    Anyway, I just want to know how long I should wait before I start to worry.

    BTW, I did give them 5 or 6 weeks in the fridge, and they are sowed in a heated seed-germinating greenhouse thingy. (pretty cool, got at home depot for $40. Holds 72 germinating chambers).
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Give them at least 8 weeks. I had some leuco seeds that started with in 4 days of sowing but it took that long for all of them to germinate
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    gardenofeden's Avatar
    Join Date
    Sep 2001
    Location
    England
    Posts
    382
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yes, give them two or three months. If they don't germinate, leave them till the next year and they may pop-up then
    Stephen
    Sarracenia rosea?...don't be ridiculous!

Similar Threads

  1. roseana gemmae, burmannii seeds, and aliciae seeds
    By trek623 in forum Carnivorous Plant Trading Post
    Replies: 2
    Last Post: 12-20-2008, 06:19 PM
  2. N. mirabilis 'red lips' seeds trade for nep seeds
    By alec in forum Carnivorous Plant Trading Post
    Replies: 0
    Last Post: 10-19-2008, 07:35 AM
  3. Replies: 15
    Last Post: 08-05-2008, 05:36 PM
  4. Replies: 8
    Last Post: 07-08-2008, 11:59 AM
  5. Seeds, Seeds lots of Seeds (Sarracenia) winner Captain Hamata $30
    By Ozzy in forum 2008 NASC Benefit Auction
    Replies: 12
    Last Post: 07-07-2008, 04:37 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •